Informace

A2. Usnadněná difúze - biologie


Zvažte následující mechanismus:

Předpokládejme, že pro tento systém bude změřen počáteční tok. Chtěli bychom odvodit rovnice, které ukazují (J ) jako funkci (A_ {out} ) (za předpokladu, že (A_ {in} ) je v časovém průběhu měření počátečního toku zanedbatelný. že zprostředkovaná (J ) je mnohem větší než (J ) pasivní. Na rozdíl od pasivní difúze není JA úměrná (A_ {out} ), ale spíše ([A_ {bound}] ).

Zvažte tento příklad, který vám pomůže pochopit tuto proporcionalitu. Předstírejte, že receptor je nákladní vůz, který může přenášet jednu částici přes membránu najednou (tj. 1/1 stechiometrie). Předpokládejme také, že se částice nemohou dostat, aniž by je nesl kamion. Pokud v membráně nejsou žádné nákladní automobily, nelze dodat žádné zatížení. Pokud jsou v membráně nákladní automobily, ale nejsou v nich žádné částice, nebude doručeno žádné zatížení. Vzhledem k tomu, že se zvyšuje počet částic, které jsou k dispozici k naložení do nákladního vozu, bude mít nákladní vůz větší šanci na naložení (samozřejmě v závislosti na afinitě částic k nákladnímu vozidlu). Pokud se počet naložených nákladních vozidel zdvojnásobí, počet částic vysypaných na druhou stranu se zdvojnásobí. Analogicky je tedy (JA ) úměrné ([RA] ):

[ begin {align} JA & propto [RA] nonumber [5pt] & = k_3 [RA] nonumber end {align} label {1} ​​]

Jak můžeme vypočítat (RA ), když víme (A ) a (R )? Předpokládejme, že (A_ {total} ) ( (A_0 )) je mnohem větší než (R_0 ), což je pravděpodobný biologický případ, a (A_ {in} = 0 ). Můžeme vypočítat (RA ) pomocí následujících rovnic a stejný postup jsme použili pro odvození vazebné rovnice:

[ML = dfrac {M_oL} {K_d + L} ]

Disociační konstanta:

[K_d = dfrac {[A] _ {eq} [R] _ {eq}} {[AR] _ {eq}} = dfrac {[A] [R]} {[RA]} label { 2} ]

(K_d ) má jednotky molarity.

Hmotnostní bilance R:

[R_o = R + RA štítek {3A} ]

tak

[R = R_o -RA štítek {3} ]

Protože budeme předpokládat, že (A_o ) je mnohem větší než (R_0 ), nebudeme potřebovat hmotnostní bilanci pro (A ) (což je (A_o = A + RA ))

Náhradní rovnice ref {3} do ref {2}:

[(RA) K_d = (Ro) A - (RRA) A ]

[(RA) K_d + (RA) A = (Ro) A ]

[RA = (Ro) dfrac {A} {K_d + A} štítek {4} ]

Náhrada ref {4} do rovnice ref {1} dává konečnou rovnici,

[JA = konst [RA] = k_3 [RA] = k_3 (R_o) dfrac {A} {K_d + A}. štítek {5} ]

Z těchto rovnic by vám mělo být jasné, že:

  • děj (JA ) vs. (A ) je hyperbolický
  • (JA = 0 ) když (A = 0 ).
  • (JA = J_ {max} ) když (A ) je mnohem větší než (K_d )
  • (A = K_d ) když (JA = J_ {max}/2 ).

Přehrávač CDF Wolfram Mathematica - Jo vs A (vyžaduje se bezplatný plugin)

Jsou to stejné podmínky, jaké jsme podrobně popsali pro pochopení vazebné rovnice

[ML = dfrac {M_oL} {K_d + L} ]

RYCHLÉ PŘEDPOKLAD EQUILIBRIUM

Tato derivace je založena na předpokladu, že relativní koncentrace (A ), (R ) a (AR ) lze určit pomocí (K_d ) interakcí a koncentrací každého druhu během raná část difúze (tj. za podmínek počáteční rychlosti). Pamatujte, že za těchto podmínek se (A_ {out} ) s časem příliš nemění. Je to platný předpoklad? Prozkoumejte mechanismus zobrazený na výše uvedeném obrázku. (A_ {out} ) se váže na (R ) s rychlostní konstantou druhého řádu (k_1 ). RA má dva osudy. Může se disociovat s rychlostní konstantou prvního řádu (k_2 ) na Aout + R (pro získání původního druhu), nebo disociovat s rychlostní konstantou prvního řádu k3 za vzniku (A_ {in} ) + (R ) (jak se A pohybuje přes membránu). Pokud budeme předpokládat, že (k_2 gg k_3 ) (tj. Že komplex se rozpadá mnohem rychleji, než je nesen A), pak relativní poměry (A ), (R ) a (RA ) lze popsat pomocí (K_d ). Případně o tom můžete přemýšlet tímto způsobem. Pokud se (A ) váže na (R ), většina (A ) se disociuje a malé množství bude přeneseno přes membránu. Pokud k tomu dojde, pak je (R ) nyní zdarma a rychle sváže (A_ {out} ) a provede novou rovnováhu. K tomu dochází, protože nejpravděpodobnějším osudem vázaného A je disociace, nikoli přenos přes membránu, protože (k_3 ll k_2 ).

Difúze iontů a molekul přes membrány

Jak jsme viděli dříve, koeficienty propustnosti syntetických membrán (lipozomů) pro rozpuštěné látky souvisí s velikostí a polaritou rozpuštěné látky.

Obrázek: koeficienty propustnosti

Menší ionty s vyšší hustotou náboje (jako ( ce {Na^{+}} )) mají nižší koeficient propustnosti než větší ionty s nižší hustotou náboje (jako ( ce {K^{+}} ) ). A co přírodní membrány? Podívejte se na graf níže.

Stůl 1: Koeficient propustnosti (cm/s) přírodních a syntetických membrán pro D-glukózu a D-mannitol při 25 ° C.
Příprava membrányD-glukózaD-mannitol
Syntetická lipidová dvojvrstva (2,4 krát 10^{-10} ) (4,4 krát 10^{-11} )
Vypočítaná pasivní difúze (4 krát 10^{-9} ) (3 krát 10^{-9} )
Neporušený lidský erytrocyt (červená krvinka) (2,0 krát 10-4 ) (5 krát 10^{-9} )

Proč se koeficienty propustnosti liší pro D-Glc a D-mannitol přes membránu červených krvinek?


Glukokortikoidní receptory se podílejí na regulaci pulzujícího vylučování močoviny u muchomůrky

Cílem této studie bylo charakterizovat strukturu pulzujícího vylučování močoviny v ropuchách v zálivu v důsledku exogenního zatížení kortizolem a určit receptory zapojené do regulace tohoto mechanismu. Muchomůrky byly vybaveny zavedenými arteriálními katétry a byly infuzovány isosmotickým NaCl po dobu 48 hodin, poté byly ryby ošetřeny samotným kortizolem, kortizolem+arašídovým olejem, kortizolem+RU486 (antagonista glukokortikoidového receptoru) nebo kortizol+spironolakton (antagonista mineralokortikoidního receptoru). Po naložení kortizolu došlo u ryb ošetřených samotným kortizolem, kortizolem+olejem nebo kortizolem+spironolaktonem k dvojnásobnému až trojnásobnému snížení pulzující exkrece močoviny. Toto snížení bylo způsobeno zmenšením velikosti pulzů močoviny bez vlivu na frekvenci pulsů ve srovnání s hodnotami naměřenými během kontrolní infúze NaCl. Tyto ryby navíc po ošetření vykazovaly zvýšení plazmatických koncentrací močoviny. Tyto zjevné účinky léčby kortizolem byly zrušeny u ryb ošetřených kortizolem+RU486. Naproti tomu tyto ryby vykazovaly zvýšení pulzativního vylučování močoviny zprostředkované dvojnásobným zvýšením velikosti pulsu bez změny frekvence. Podobně ryby ošetřené kortizolem+RU486 vykazovaly v průběhu experimentu významný pokles plazmatických koncentrací močoviny. Zjištění této studie naznačují, že vysoké hladiny kortizolu snižují pulzující vylučování močoviny snížením velikosti pulzu. Kromě toho se zdá, že na regulaci mechanismu exkrece pulzující mořské mořské ryby se podílejí glukokortikoidní receptory, a nikoli mineralokortikoidní receptory.

Toto je náhled obsahu předplatného, ​​přístup prostřednictvím vaší instituce.


Transport bakteriálních buněk

Každá živá buňka vyžaduje od svého okolí suroviny pro biosyntézu a produkci energie a musí do svého okolí uvolňovat vedlejší produkty metabolismu. Několik nepolárních sloučenin se může rozpustit v lipidové dvojvrstvě a procházet membránou bez pomoci, ale pro polární nebo nabité sloučeniny nebo ionty je membránový protein nezbytný pro pohyb přes membránu. V některých případech membránový protein jednoduše usnadňuje difuzi rozpuštěné látky po jejím koncentračním gradientu, ale k transportu často dochází proti gradientu koncentrace, elektrického náboje nebo obojímu, v takovém případě musí být rozpuštěné látky „čerpány“ v procesu, který vyžaduje energii . Iony se mohou také pohybovat přes membrány prostřednictvím iontových kanálů tvořených proteiny, nebo je mohou přenášet ionofory, malé molekuly, které maskují náboj iontů a umožňují jim difundovat lipidovou dvojvrstvou. Až na velmi málo výjimek je provoz malých molekul přes plazmatickou membránu zprostředkován proteiny, jako jsou transmembránové kanály, nosiče nebo pumpy.

A) Pasivní difúze

Pohyb molekul přes membránu pasivním transportem nevyžaduje vstup metabolické energie. Molekula se pohybuje z vysoké koncentrace do nižší koncentrace. Pasivní transport jednoduchou difúzí nevyžaduje přítomnost integrálních membránových proteinů. Rychlost pohybu molekuly (např. Vody, plynů a močoviny) jednoduchou difúzí je přímo úměrná jejímu koncentračnímu gradientu přes membránu.

B) Usnadněná difúze

Pasivní transport usnadněnou difúzí vyžaduje přítomnost specifických integrálních membránových proteinů, které usnadňují pohyb molekuly (např. Glukózy, jiných cukrů, aminokyselin atd.) Přes membránu. Transportní protein (např. Transportér glukózy erytrocytů) je specifický pro konkrétní molekulu, je saturovatelný, vykazuje kinetiku vazby a je ovlivňován teplotou, pH a inhibitory.

Usnadněná (nebo zprostředkovaná nosičem) difúze molekuly přes biologickou membránu je závislá na specifických integrálních membránových proteinech, často nazývaných uniportéry. Molekula se váže na protein na jedné straně membrány, protein pak prochází konformační změnou, transportuje molekulu přes membránu a poté ji uvolňuje na druhé straně. Molekuly transportované přes membrány zahrnují hydrofilní molekuly, jako je glukóza, jiné cukry a aminokyseliny. Transportní proteiny jsou specifické pro jednu konkrétní molekulu nebo skupinu strukturně podobných molekul. Transportní proteiny mohou být nasycené a jsou ovlivněny teplotou, pH a molekulami inhibitoru.

C) Aktivní doprava

Aktivní transport probíhá proti koncentračním gradientům a je zprostředkován nosnými proteiny. Metabolická energie se používá k pohybu iontů nebo molekul proti koncentračnímu gradientu. Aktivní transport má za následek akumulaci rozpuštěné látky na jedné straně membrány. Aktivní transport je dvou typů Primární aktivní transport a Sekundární aktivní transport.

Sekundární aktivní transport

Sekundární aktivní transport je také známý jako nepřímý transport. Je to transformace molekul a iontů zprostředkovaná proteinovým nosičem. K tomu dochází, když je endergonický (do kopce) transport jedné rozpuštěné látky spojen s exergonickým (z kopce) tokem jiné rozpuštěné látky, která byla původně čerpána primárním aktivním transportem. Sekundární aktivní transport je buď symport nebo antiport, v závislosti na tom, zda se dva soluty pohybují stejným nebo opačným směrem.

Koncept uniportu, symportu a antiportu

Jedná se o typy aktivního transportu, které potřebují nosný protein pro transformační molekuly z jedné strany na druhou stranu membrány.

Symport – Když se transportovaná molekula a společně transportovaný ion pohybují stejným směrem, tento proces se nazývá symport.

Antiport – Když se transportovaná molekula a společně transportovaný ion pohybují opačným směrem, proces se nazývá antiport.

Uniport – Transportéry přenášejí pouze jednu látku z jedné strany na druhou stranu membrány, která je známá jako uniport.

Transportér Na + -glukózy: Příklad sekundárního aktivního transportu

Běžným příkladem sekundárního aktivního transportu je symport Na ‘a glukózy. Transmembránový protein Na-glukózový transportér také známý jako Na-glukózový ko-transportéry nebo symporty umožňuje Na a glukóze vstoupit společně do buňky. Na -glukózové symporty jsou skupinou transportérů glukózy přítomných na apikálním povrchu (obráceném k lumenu) epiteliální buňky tenkého střeva a aktivně transportují molekuly glukózy do buňky ze střeva. Na + proudí po svém koncentračním gradientu, zatímco molekuly glukózy jsou transportovány proti svému koncentračnímu gradientu do buňky.

Později je Na + pumpováno zpět z buňky Na + -K + ATPázou a udržuje tak vnitřní Na + gradient. GLUT omezená na bazolaterální (bazální a laterální) povrchy buňky umožňuje stejné molekule opustit buňku usnadněnou difúzí do extracelulární tekutiny na druhé straně epitelu.

Podobně laktózová permeáza (také známá jako galaktosidová permeáza) přítomná v plazmatické membráně bakterií, jako je E. coli, využívá protonový gradient přes membránu ke společnému transportu protonů a laktózy (laktózový protonový symport).

D) Skupinová translokace

Neaktivní transport, molekuly rozpuštěné látky se pohybují přes membránu bez úprav. Mnoho prokaryot také přijímá molekuly skupinovou translokací, což je proces, při kterém je molekula transportována do buňky, přičemž je chemicky změněna. Například systém Phosphoenolpyruvate: Sugar phosphotransferase (PTS). Transportuje různé cukry, zatímco je fosforyluje pomocí fosfoenolpyruvátu (PEP) jako dárce fosfátu.

PEP + cukr (venku) - & gt Pyruvate + Sugar-P (uvnitř)

V E. coli a Salmonella typhimurium se skládá ze dvou enzymů a tepelně stabilního proteinu (HPr) s nízkou molekulovou hmotností. HPr a enzym I (EI) jsou cytoplazmatické. Enzym II (EII) má variabilnější strukturu a často se skládá ze tří podjednotek nebo domén. EIIA je cytoplazmatická a rozpustná. EIIB je také hydrofilní, ale často je připojen k EIIC, hydrofobnímu proteinu, který je uložen v membráně. Vysokoenergetický fosfát se přenáší z PEP na enzym II (EII) pomocí enzymu I (EI) a HPr. Poté je molekula cukru fosforylována, protože je přenášena přes membránu enzymem II (EII). Enzym II (EII) transportuje pouze specifické cukry a mění se s PTS, zatímco enzym I (EI) a HPr jsou společné všem PTS ’s.


Fyziologie a vývoj transportu močoviny u ryb

Tento přehled shrnuje to, co je v současné době známo o transportérech močoviny v rybách v kontextu jejich fyziologie a vývoje mezi obratlovci. Existence transportérů močoviny byla zkoumána v červených krvinkách a hepatocytech ryb, stejně jako v ledvinových a větvových buňkách. Málo je známo o transportu močoviny v červených krvinkách a hepatocytech, ve skutečnosti se nevěří, že by transportéry močoviny byly přítomny v erytrocytech elasmobranchů ani v teleostech ryb. To málo fyziologických důkazů, které existují pro transport močoviny přes rybí hepatocyty, není podloženo molekulárními důkazy a lze to vysvětlit jinými transportéry. Naproti tomu rané nálezy na elasmobranch transportérech renální močoviny byly podnětem pro výzkum v jiných organismech. Transport močoviny v ledvinách i žaberách elasmobranch slouží k udržení močoviny uvnitř zvířete proti masivnímu koncentračnímu gradientu s prostředím. Informace o rozvětvových a ledvinových transportérech močoviny u teleostních ryb jsou ve srovnání s nedávnými daty, ale v teleostech se zdá, že transportéry močoviny fungují na vylučování a nikoli retenci jako u elasmobranch. Přítomnost transportérů močoviny v rybách, které produkují velké množství močoviny, jako jsou elasmobranchy a ureotelické teleosty, je rozumná. Existence transportérů močoviny v amoniotelických rybách je však kuriózní a pravděpodobně je způsobena jejich schopností vyrábět močovinu v raném věku jako prostředek, jak se vyhnout toxicitě amoniaku. Předpokládá se, že genová rodina usnadněného difuzního močovinového transportéru (UT) prošla velkými evolučními změnami, pravděpodobně ve spojení s rolí transportu močoviny ve vývoji terestriality u obratlovců.

Toto je náhled obsahu předplatného, ​​přístup prostřednictvím vaší instituce.


Materiály a metody

Experimentální zvířata

Muchomůrka zálivová [Opsanus beta Goode a Bean 0,074 ± 0,003 kg (N.= 50) dosah, 0,044–0,140 kg] byly zachyceny válečkovou vlečnou sítí komerčními krevetami v Biscayne Bay na Floridě v zimě 2002–2003. Muchomůrky byly drženy ve venkovní nádrži v zařízení pro držení krevet s tekoucí mořskou vodou (okolní sezónní podmínky) ne déle než 24 hodin po odchytu, poté byly přeneseny do laboratoře, kde byly drženy až jeden měsíc. V den přenosu do laboratoře byly ryby ošetřeny dávkou malachitové zeleně (konečná koncentrace 0,05 mg l – 1) ve formalinu (15 mg l – 1) (AquaVet, Hayward, CA, USA), aby se zabránilo infekci ciliate Kryptokaryonové dráždivé látky (Stoskopf, 1993). Zpočátku byly ryby drženy v 50litrových skleněných akváriích s tekoucí, provzdušněnou mořskou vodou. Ryby byly chovány v tomto relativně přeplněném prostředí (> 1010 ryb na nádrž), aby se zahájil přechod na ureotelismus (Walsh et al., 1994). Teplota vody byla 24–26 ° C. Ryby byly krmeny každý týden chobotnicí až do doby operace.

Experimentální protokol

Jak nastínili Wood et al. (1997) a McDonald et al. (2000), katetrizace kaudální arterie byly provedeny na rybách anestetizovaných MS-222 (0,5 gl – 1 Sigma-Aldrich, St Louis, MO, USA) a obalených mokré ručníky. Intraperitoneální (i.p.) katétry (Clay-Adams PE50) naplněné toadfish fyziologickým roztokem (Walsh, 1987) byly vloženy přes malý ventrální řez a provlečeny přibližně 4 cm uvnitř tělní dutiny. Rána byla ošetřena práškem oxytetracyklinu, aby se zabránilo infekci, a katétr bezpečně sešil v místě výstupu hedvábím 3-0. Další sutura zajistila katétr těsně před incizí arteriálního katétru a další dva jej zajistila podél arteriálního pouzdra PE 160. Ryby byly ponechány nerušeně se zotavit v jednotlivých stíněných komorách toku s krytem z PVC trubky po dobu 24 hodin, kdy byla potvrzena průchodnost arteriálních katetrů. Fungující arteriální a i.p. katétry byly poté ponechány mimo tavivovou komoru připojenou ke stříkačce, aby nerušily ryby podruhé hledáním katetrů v komoře. Ryby byly ponechány přes noc (celkem 36 hodin regenerace), poté byl tok vody do tavicí komory zastaven. Aniž by byla ryba rušena, hladina vody rychle klesla na přesnou značku objemu 1,35–2,0 litru malým otvorem v tokové komoře a energické provzdušňování udržovalo důkladné promíchání a parciální tlak kyslíku (PÓ2) blízko nasycení vzduchu. Byl odebrán vzorek vody (5 ml) pro měření počáteční koncentrace močoviny a amoniaku a [3H] PEG 4000. Poté byly každou hodinu odebírány vzorky vody až do injekce prvního farmakologického činidla (viz níže), poté byly po zbývající část experimentu odebírány vzorky vody přibližně každých 30 minut (není -li uvedeno jinak).

Farmakologické experimenty

Byly provedeny farmakologické experimenty za účelem stanovení 5-HT receptorů zapojených do spouštění pulzního mechanismu vylučování močoviny muchomůrkou v zálivu. Farmakologické látky použité v této studii zahrnovaly selektivní 5-HT1A agonista receptoru 8-OH-DPAT [8-hydroxy-2- (di-n-pro-pylamino) tetralin hydrobromid Sigma-Aldrich], 5-HT2 agonista receptoru a-methyl-5-HT (Sigma-Aldrich) a 5-HT2 antagonista receptoru ketanserin (tartrátová sůl ketanserinu Sigma-Aldrich). Bylo provedeno osm různých experimentálních sérií. V řadě 1 a řadě 2 byly rybám injekčně podány (1 μmol ml –1 fyziologický roztok kg –1 ryba) buď 8-OH-DPAT (N.= 6) orα-methyl-5-HT (N.= 27) přes arteriální katétr následovaný 3 ml kg –1 fyziologického roztoku muchomůrky. Tato dávka byla vypočítána tak, aby poskytla cirkulující koncentrace 3 × 10–6 mol l – 1, což je blízké hladinám cirkulujícího serotoninu měřeným u ropuchy (10–7 –10 –6 mol l – 1) a identické s dávkou použitého serotoninu na ropuchu v nedávné studii (Wood et al., 2003). V samostatné experimentální sérii (řada 3) byla zkoumána možnost zvýšení nespecifické odvětvové permeability v reakci na injekci α-methyl-5-HT injekcí dávky 50 μCi kg –1 tělesné hmotnosti [3 H] PEG 4000 (Perkin Elmer, Wellesley, MA, USA) přes kaudální arteriální katétr následovaný dalšími 3 ml kg –1 fyziologického roztoku (N.= 8). Muchomůrky pak byly ponechány přes noc, aby byla umožněna rovnováha [3H] PEG 4000 v celém extracelulárním prostoru, jak popsal McDonald et al. (2000). V sérii 4 byla měřena doba, po kterou α-methyl-5-HT vyvolal pulz močoviny (N.= 6). V této sérii byl spuštěn časovač bezprostředně po injekci první ropuchy a vzorky vody byly odebírány přesně každých pět minut po dobu dalších 50 minut. Současně byla každá zbývající ryba injikována a zaznamenána doba injekce. Poté byl stanoven odhad času, který potřeboval na pulz každé jednotlivé ryby. Ve čtyřech samostatných experimentálních sériích (řada 5, N.= 4 řada 6, N.= 5 řada 7, N.= 5 řada 8, N.= 7), čtyři různé dávky 5-HT2 byl injekčně podán antagonista receptoru ketanserin (0,01, 0,1, 1 a 10 μmol ml –1 kg –1) přes i.p. katetr v 45%(hmotn./obj.) HBC (2-hydroxypropyl-β-cyklodextrin, netoxický solubilizátor Sigma-Aldrich) hodinu před arteriální injekcí a-methyl-5-HT. Vzhledem k potřebě solubilizačního činidla, i.p. injekce ketanserinu byla považována za vhodnější způsob léčby.

Analytické techniky a výpočty

Koncentrace močoviny v krvi a vodě byly měřeny metodou diacetylmonoximu podle Rahmatullaha a Boyda (1980) s příslušným nastavením síly činidla pro různá rozmezí koncentrací močoviny ve vodě a krevní plazmě. Koncentrace amoniaku ve vodě byly měřeny metodou indofenolové modři (Ivancic a Degobbis, 1984). Koncentrace plazmatického kortizolu byly měřeny za použití komerční [125I] radioimunotestovací soupravy (ICN Biomedicals Inc., Costa Mesa, CA, USA) se standardy zředěnými na stejné rozmezí proteinů jako plazma muchomůrky. Pro měření [3H] PEG 4000 byly vzorky vody (2 ml) přidány k 10 ml Ecolume fluoru (ICN Biomedicals Inc.) a analyzovány scintilačním počítáním na počítadle TM Analytic 6895 BetaTrac.

Statistika

Data jsou uváděna jako průměr ± 1 s. e. m. (N.= počet ryb). V případě, že jsou porovnávány pouze dva průměry, byla významnost rozdílů mezi průměry hodnocena pomocí Studentova nepárového dvoustranného t-test(P& lt0.05 Nemenyi et al., 1977). Při pohledu na význam rozdílů mezi léčenou skupinou v průběhu času byla použita jednosměrná analýza opakovaných měření rozptylu (ANOVA) s časem jako hlavním faktorem a po ní následovala Bonferroniho korekce pro vícenásobné srovnání. Při pohledu na význam rozdílů mezi dvěma léčebnými skupinami v průběhu času byla použita dvoucestná opakovaná měření ANOVA s časem a léčebnou skupinou jako hlavními faktory a následovaný Holm-Sidakovým testem pro srovnání více vzorků.


Účinky balení lipidů na chování polymorfní fáze a vlastnosti membrány

Vlastní sestavení molekul fosfolipidů ve dvouvrstvé formě bylo zvažováno z hlediska ekvivalentních molekulárních tvarů představujících intermolekulární síly. Ekvivalentní velikost každé fosfolipidové hlavní skupiny byla aproximována čistým atomovým objemem plus objemem souvisejících molekul vody, které byly odvozeny z experimentů dělení vody/uhlovodíků. Ekvivalentní délky nenasycených acylových řetězců byly odvozeny z údajů o retenčním čase z chromatografických měření. Spontánní zakřivení různých fosfolipidových monovrstev bylo vypočítáno z jejich ekvivalentních molekulárních tvarů a byla vypočtena energie potřebná k jejich zploštění do dvouvrstvé roviny za použití známého modulu ohybu. Se zvyšující se energií ohybu vykazovaly směsi rostoucí citlivost na fosfolipázu A2, usnadňovaly rychlost přenosu lipidů proteiny fosfolipidové výměny, propustnost pro karboxyfluorescein, začlenění proteinů lidských erytrocytů a transport vápníku Ca-ATPázou ze sarkoplazmatického retikula v rekonstituovaných vezikulách. Když byl výpočet aplikován na známé lipidové kompozice devíti buněčných membrán, bylo zjištěno, že poměr protein/lipid a poměr fosfolipidů/cholesterolu má pozitivní, respektive negativní korelaci s latentní energií ohybu fosfolipidů. Náklady na energii v souladu s dvouvrstvou fází mohou být důležitým fyzikálním parametrem, pokud jde o aktivitu a biogenezi membrán.


Transportní funkce cholesterolu esterázy pankreatické cholesterolu: Přímé vychytávání sterolů a esterifikace v enterocytech

Zobrazení článků jsou součtem stažení textových článků od listopadu 2008 (PDF i HTML) v souladu s COUNTER ve všech institucích a jednotlivcích. Tyto metriky jsou pravidelně aktualizovány, aby odrážely využití, které vedlo až do posledních dnů.

Citace jsou počet dalších článků citujících tento článek, vypočítaný společností Crossref a aktualizovaný denně. Najděte více informací o počtech citací Crossref.

Altmetric Attention Score je kvantitativní měřítko pozornosti, které se výzkumnému článku dostalo online. Kliknutím na ikonu koblihy se načte stránka na altmetric.com s dalšími podrobnostmi o skóre a přítomnosti sociálních médií pro daný článek. Najděte více informací o altmetrickém skóre pozornosti a způsobu výpočtu skóre.

Poznámka: Místo abstraktu je toto první stránka článku.


A2. Usnadněná difúze - biologie

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Oddělení chirurgie a fyziologie, Ústav lékařských věd, Lékařská fakulta, Univerzita v Torontu

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Oddělení chirurgie a fyziologie, Ústav lékařských věd, Lékařská fakulta, Univerzita v Torontu

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

Ústav farmakologie, Zhongshan School of Medicine, Sun Yat-sen University

2016 Volume 80 Issue 11 Pages 2397-2406

  • Publikováno: 25. října 2016 Přijato: 09. srpna 2016 Vydáno na J-STAGE: 25. října 2016 Přijato: 23. září 2016 Předběžná online publikace: 19. října 2016 Revidováno: 18. září 2016

(kompatibilní s EndNote, Reference Manager, ProCite, RefWorks)

(kompatibilní s BibDesk, LaTeX)

Pozadí: Předchozí výzkum ukázal, že ClC-3 je zodpovědný za objemově regulovaný Cl-proud (Tř. Vol) v buňkách hladkého svalstva cév (VSMC). Stále však není jasné, zda a jak je ClC-3 transportován do buněčných membrán, což má za následek změnu Tř. Vol.

Metody a výsledky: Objemově regulovaný chloridový proud (Tř. Vol) byl zaznamenán záznamem kleště na celobuněčnou záplatu a byl proveden Western blot a koimunoprecipitace za účelem vyšetření exprese proteinu a interakce protein-protein. K pozorování transportu ClC-3 bylo použito zobrazení živých buněk. Výsledky ukázaly, že by se mohla zvýšit nadměrná exprese endofilinu A2 Tř. Vol, zatímco knockdown endofilinu A2 klesl Tř. Vol. Kromě toho doména SH3 endofilinu A2 zprostředkovala jeho interakci s ClC-3 a podporuje transport ClC-3 z cytoplazmy do buněčných membrán. Regulace aktivity kanálu ClC-3 byla také ověřena v bazilárních buňkách hladkého svalstva tepen (BASMC) izolovaných z transgenních myší endofilinu A2. Navíc endofilin A2 zvyšuje proliferaci VSMC indukovanou endotelinem-1 nebo hypo-osmolaritou.

Závěry: Tato studie identifikovala endofilin A2 jako partnera kanálu ClC-3, který slouží jako nový pohled na obchodování s ClC-3 při regulaci Tř. Vol ve VSMC. Tato studie poskytuje nový mechanismus, kterým endofilin A2 reguluje aktivitu kanálu ClC-3, a objasňuje, jak je ClC-3 transportován do buněčných membrán, aby hrál svou kritickou roli jako chloridový kanál ve funkci VSMC, které se mohou podílet na kardiovaskulárních chorobách . (Circ J 2016 80: 2397–2406)

Homeostáza objemu buněk je základní fyziologickou aktivitou v eukaryotických buňkách. Během regulace objemu buňky v reakci na bobtnání buněk je výtok K + a Cl - doprovázen zvýšením osmoticky povinného uvolňování vody z buňky, což zase zmenšuje objem buňky. 1 Tento proces je známý jako snížení regulačního objemu (RVD) a objemově regulované aniontové kanály (VRAC) jsou zásadní pro regulaci objemu buněk po bobtnání u většiny typů obratlovců. Ačkoli byly fyziologické a patologické funkce VRAC podrobně popsány, jeho molekulární identita zůstává kontroverzní. Nedávno byl identifikován SWELL 1 (opakování bohaté na leucin obsahující 8A, LRRC8A) jako nezbytná součást objemově regulovaného aniontového kanálu, který je blízko nebo tvoří póry objemově regulovaného chloridového kanálu pomocí screening RNAi v genomu v buňkách HEK293T. 2, 3 Molekulární složení VRAC však ještě není zdaleka vyřešeno. Jak bylo nedávno popsáno v buňkách lidského sítnicového pigmentového epitelu, bestrofin 1 je nepostradatelný pro regulaci objemu. 4 S ohledem na tato pozorování je stále jasnější, že VRCC může být spíše komplexem aniontových kanálů tvořeným buněčným typem nebo složením specifickým pro tkáň než jediným všudypřítomným kanálem. 4

ClC-3, člen rodiny kanálů ClC Cl-napěťově řízených, je kritický pro regulaci objemu buněk, proliferaci, apoptózu a redoxem zprostředkovanou signalizaci, 5-9, a je tedy silně zapojen do patologie hypertenzní cerebrovaskulární remodelace, 10 - 12 aterogeneze, 13 a vaskulární zánětlivé reakce. 14, 15 Naše předchozí studie odhalily, že hypotonické řešení evokovalo nativní objemově regulovaný navenek usměrňující Cl-proud (Tř. Vol), s poklesem koncentrace Cl cytoplazmy ([Cl -]) v buňkách hladkého svalstva cév (VSMC). Odpověď [Cl -] a Tř. Vol k hypotonické provokaci lze zvýšit nadměrnou expresí ClC-3 a inhibovat antisense ClC-3. Proudy ve VSMC (Tř. Vol) a v ClC-3-VSMC (Cl.ClC-3) jsou zakázány intracelulární dialýzou protilátky anti-ClC-3. Současné důkazy tomu navíc nasvědčují Tř. Vol a Cl.ClC-3 sdílejí stejné farmakologické vlastnosti a regulační mechanismy, jako je PKC a PTK regulace Cl - proudů. 16

Prokázali jsme, že protein ClC-3 je široce distribuován v cytoplazmě a buněčné membráně A10 VSMC a primární kultuře BASMC. Přestože je ClC-3 primárně lokalizován v cytoplazmě některých typů buněk, protein ClC-3 mohl být přechodně transportován na buněčnou membránu během endocytózy zprostředkované klarinem, 17 což naznačuje existenci dynamického mechanismu regulujícího subcelulární distribuci proteinu ClC-3 . Transport klíčových proteinových členů iontového kanálu z intracelulárního kompartmentu do buněčné membrány prostřednictvím raketoplánu se ukazuje jako klíčový faktor zapojený do regulace iontového kanálu. 18, 19

Endofiliny jsou rodinou evolučně konzervovaných proteinů, které jsou dobře zdokumentovány v cestě endocytózy, kde se endofiliny mohou vázat na buněčnou membránu, indukovat ohýbání membrány za vzniku molekulárního lešení a poté podporovat efektivní obchodování s endocytotickými proteiny. 20 Mezi nejvíce extenzivně studovanými členy rodiny endofilinu A je endofilin A2, který je všudypřítomně exprimován v eukaryotických buňkách. All forms of endophilins contain 2 major functional domains: N-terminal Bin-amphiphysin-Rvs (BAR) domain and C-terminal Src homology 3 (SH3) domain. During the membrane remodeling process, the N-BAR domains are sensors of membrane curvature and provide a molecular scaffold that combine bending activities with specific protein-protein interacting processes and the SH3 domain is the linker region by which endophilins can recognize proline-rich domains (PRDs) and recruit the essential membrane-trafficking proteins. Accumulating evidence also support an emerging role for endophilins in the functions of cell membrane receptors via protein trafficking mechanisms. 20 – 22 For example, a direct interaction between endophilin A2 and a voltage-dependent Ca 2+ channel are required for synaptic vesicle endocytosis, and the PRDs within endophilin A2 serve to sense the intracellular Ca 2+ concentration and regulate the formation of the endophilin-Ca 2+ channel complex. 23 To date, whether and how endophilin A2 is involved in regulating Cl.vol, subcellular distribution of ClC-3 proteins, and VSMC proliferation remains unclear.

In the present study, we found endophilin A2 is expressed abundantly in BASMCs, we also demonstrated that endophilin A2 participates in the regulation of hypotonic-activated Cl.vol in BASMCs. BASMCs isolated from endophilin A2 transgenic mice exhibited a high degree of ClC-3 protein accumulation on the cell surface of BASMCs, a marked enhancement of hypotonic-induced Cl.vol, and elevated endothelin-1 or hypotonic-induced BASMC proliferation. By constructing three deletion mutants that failed to induce the function of the SH3, PRD or BAR domain in endophilin A2, the ClC-3 binding site in endophilin A2 was ascribed to the C-terminal SH3 domain. The SH3 deletion mutant of endophilin A2 completely abolished its association with ClC-3 and resulted in a significant decrease in cell membrane localization of ClC-3. Our findings suggest an endophilin A2-mediated protein trafficking mechanism, coupling intracellular ClC-3 to cell membrane Cl.vol for VSMC functions.

The full-length endophilin A2 sequence was amplified from cultured rat BASMCs using TRIzol reagent (Invitrogen). Then the coding sequence of endophilin A2 was amplified using full-length cDNA as a template, and the primers were ATGTCGGTGGCGGGGCTGAAGAAG (forward) and TCACTGAGGCAGAGGCACCAG (reverse). The construction of the recombinant plasmid pCMV-endophilin A2-flag was performed by using an overlap extension poly-merasechainreaction (PCR) cloningmethod.

Endophilin A2 Transgenic Mice

The full-length murine endophilin A2 cDNA coding sequence was infused into an EX3d-CMV-IRES vector. After linearization and subsequent gel-purification, this vector was microinjected into the pronuclei of fertilized C57BL/6J mouse eggs. PCR was used for genotyping. The primers used for genotyping were: 5′-CCAAAATGTCGTAACAACTCCG-3′ (forward) and 5′-GGCCTTACTGGTGATATCCACT-3′ (reverse).

The siRNA (small interfering RNA) duplexes against the rat endophilin A2 gene (Gene ID: 81922) was designed and constructed by QIAGEN and transfected with Hyperfect Transfection Reagent, according to the manufacturer’s instructions (QIAGEN). The working concentration of endophilin A2 siRNA was 40 nmol/L. A negative siRNA (QIAGEN) was used as a negative control. The cells were then used for western blot and patch-clamp studies after 48 h.

BASMC Isolation and Culture

Basilar arterial smooth muscle cells were isolated and cultured, as previously described. 11 Freshly isolated BASMCs were stored at 4℃ and used for patch-clamp experiments within 10 h. The BASMC cells in passage 8 through 12 were used for cell proliferation assays.

Cell Culture and Plasmid Transfection

The A10 vascular smooth muscle cells (American Type Culture Collection) were cultured at 37℃ under 5% CO2 in DMEMF/12 supplemented with 10% fetal bovine serum (Sigma-Aldrich) and 1% penicillin-streptomycin, as previously described. 15 Plasmids were transfected into the cells at 80% confluence with Lipofectamine 2000, according to the manufacturer’s instruction (Invitrogen).

The whole-cell Cl – currents were recorded with an Axopatch 200B Amplifier (Axon Instruments, Foster City, CA, USA), as previously described. 16 Briefly, the currents were elicited with voltage steps from –100 mV to +120 mV in +20 mV increment for 400 ms, and with an interval of 5 s from a holding potential of –40 mV. Currents were sampled at 5 kHz using pCLAMP8.0 software (Axon Instruments) and filtered at 2 kHz. The hypotonic bath solution contained (mmol/L): N-methyl-D-glucamine chloride (NMDG-Cl) 107, MgCl2 1.5, MnCl2 0.5, CdCl2 0.5, GdCl3 0.05, glucose 10, and Hepes 10 pH 7.4 was adjusted with NMDG. The osmolarity of this solution, measured by a freezing-point depression osmometer (OSMOMAT030 Germany), was 230 mOsm/L. The isosmotic bath solution was the same as the hyposmotic bath solution, except that the osmolarity was adjusted by adding mannitol to 300 mOsm/L. An internal pipette solution (300 mOsm/L) contained (mmol/L): CsCl 95, TEA chloride 20, ATP-Mg 5, HEPES 5, EGTA 5, D-mannitol 80 pH 7.2 was adjusted with CsOH.

Immunoprecipitation and Western Blot Analysis

The A10 cells or cultured BASMCs were lysed in non-denaturing lysis buffer (50 mmol/L Tris, 150 mmol/L NaCl, 1 mmol/L EDTA, 1% TritonX-100) with 1% protease inhibitor. The immunoprecipitation assay was performed, as previously described. 24 Briefly, the supernatants were incubated with endophilin A2 (Santa Cruz, CA, USA), ClC-3 (Alomone Labs), or GFP antibodies (Santa Cruz) overnight at 4℃, then incubated with Protein A/G beads (Santa Cruz) for 4 h. Beads were washed three times with lysis buffer and the proteins were separated by Western Blotting.

Subcellular Fractionation Isolation

The membrane and cytosolic proteins were isolated by using a Qproteome Cell Compartment Kit (QIAGEN) according to the manufacturer’s instructions.

The A10 vascular smooth muscle cells were co-transfected with pEGFP-C1-ClC-3 plasmid and RFP-endophilin A2 full-length plasmid, or with the recombinant plasmid of endophilin A2 deletion mutants (RFP-endophilin A2-∆PRD, RFP-endophilin A2-∆SH3 plasmid or RFP-endophilin A2-∆BAR). Eight hours later, the fluorescence was monitored in a Live Cell Station (Olympus) for 10 h.

All data are expressed as mean±SEM. Statistical significance of differences between groups was determined with a Student’s 2-tailed unpaired t-test or a one-way ANOVA. Differences in current density-voltage relationships were analyzed by using a 2-way ANOVA. For western blot and cell proliferation experiments, “n” represents the number of independent experiments. For patch-clamp experiments, “n” represents the number of cells from at least 6 different batches of cells or 6 different rats. In all tests, P<0.05 was taken to be as statistically significant.

Endophilin A2 Is Expressed Abundantly in BASMCs

To determine the expression profiles of endophilin A in BASMCs, western blotting analysis was performed using cultured rat BASMCs. Endophilin A2 protein was found to be abundantly expressed in BASMCs, while antibodies against endophilin A3 detected very faint bands, and endophilin A1 was not found (Figure S1), indicating that endophilin A2 is the predominant isoform expressed in BASMCs, and may play a functional role in the vasculature.

Endophilin A2 Regulates ICl.vol and the ClC-3 Chloride Channel

Consistent with our previous findings, 16 , 25 whole-cell patch-clamp recording results showed a very small outward Cl – current in BASMCs in the resting state, and perfusion with a hypotonic solution (230 mosmol/kg H2 O) caused cell swelling and activated Cl.vol (Obrázek 1). The amplitude and current density of Cl.vol was further increased by the overexpression of endophilin A2 (Figure 1A). Conversely, the hypotonic-induced Cl.vol was markedly decreased by endophilin A2 siRNA (20 nmol/L) (Figure 1B), which could knockdown the endogenous endophilin A2 expression (Figure S2). Neither endogenous endophilin A2 protein expression nor Cl.vol was affected by the transfection of negative endophilin A2 siRNA. Moreover, intracellular dialysis of an anti-endophilin A2 antibody significantly decreased the activation of Cl.vol after perfusion with a hypotonic solution, whereas pre-absorbed anti-endophilin A2 antibody failed to alter Cl.vol under isotonic and hypotonic conditions (Figure S3). These results suggest that endogenous endophilin A2 may participate in the regulation of Cl.vol in response to hypo-osmolarity.

Endophilin A2 regulated Cl.vol in basilar arterial smooth muscle cells (BASMCs). (A) Representative traces of Cl.vol (A), I-V curves (b) and mean current densities measured at ±100 mV (C) in the control (con), GFP vector (GFP) and GFP-endophilin A2 adenovirus transfecting (GFP-endo2) groups (n=10, **P<0.05 vs. control (iso) or GFP (iso) group, *P<0.05 vs. control (hypo) or GFP (hypo) group). (B) Representative traces of ICl.vol (A), I-V curves (b) and mean current densities measured at ±100 mV (C) in the control (con), negative and endophilin A2-siRNA (endo2-siRNA) groups (n=10, **P<0.05 vs. control (iso) or neg (iso) group *P<0.05 vs. control (hypo) or neg (hypo) group).

We have documented that ClC-3 is critical for regulation of Cl.vol in VSMCs. 16 BASMCs express ClC-3 and endophilin A2 proteins endogenously, and both are involved in hypotonic-induced Cl.vol. We then examined whether endophilin A2 is associated with ClC-3 in regulating Cl.vol. Patch-clamp experiments were performed on A10 cells co-transfected with ClC-3 siRNA or GFP-tagged endophilin A2 plasmid. Overexpression of endophilin A2 resulted in a substantial increase in Cl.vol under the hypotonic condition (Figure S4). At 100 mV, the current densities of Cl.vol were increased from 42.6±8.7 pA/pF (control) to 87.6±10.1 pA/pF (GFP-endophilin A2 overexpression). Moreover, the increased hypotonic-induced Cl.vol by endophilin A2 overexpression in VSMCs was inhibited by co-transfection with GFP-endophilin A2 and ClC-3 siRNA. ClC-3 siRNA also inhibited hypotonic-induced Cl.vol, supporting our previous findings that endogenous ClC-3 is important for the activation of Cl.vol in VSMCs. Together, these data suggest that ClC-3 may be associated with endophilin A2 in regulating Cl.vol.

Endophilin A2 Regulates ClC-3 Protein Not Through Tyrosine Phosphorylation

We then examined whether endophilin A2 affected ClC-3 protein expression. Jak je uvedeno v Figures 2A a B, under isotonic conditions, neither over-expression nor knockdown of endophilin A2 could change ClC-3 protein expression in BASMCs. We have recently reported that hypo-osmolarity activates Cl.vol through phosphorylation of tyrosine residues in the ClC-3 protein rather than through increasing ClC-3 protein expression. 25 However, neither over-expression nor knockdown of endophilin A2 affected the hypotonic-induced enhancement in ClC-3 tyrosine phosphorylation (Figures 2C,D), suggesting that there might be another mechanism underlying the association of endophilin A2 and ClC-3 in regulating Cl.vol beyond the well-known protein phosphorylation/dephosphorylation.

Endophilin A2 did not influence ClC-3 expression and ClC-3 tyrosine phosphorylation induced by hypo-osmolarity. (A,B) Representative western blot illustrating that neither endophilin A2 siRNA nor adnovirus-mediated endophilin A2 overexpression (Ad-endo2) affected total ClC-3 protein levels in A10 cells (n=6). (C,D) Hypotonic-induced tyrosine phosphorylation of ClC-3 protein in A10 cells were not affected by endophilin A2 siRNA or adenovirus endophilin A2 expression. p-Y, phospho-tyrosine antibody (n=6).

Interaction of Endophilin A2 and ClC-3 Facilitates ClC-3 Trafficking to Cell Membrane

The co-immunoprecipitation assay in BASMCs demonstrated that there is an interaction between ClC-3 and endophilin A2 proteins (Figure 3A). Endophilins are best known for their functions in membrane curvature induction and/or stabilization during endocytosis. In the endocytic pathway, endophilin A2 can bind to signaling proteins and assemble and traffic these proteins between the cytoplasm and cell membrane. The ClC-3 protein is ubiquitously expressed in mammalian cells, but was reported to be located primarily in the cytoplasm of several cell types. 17 We therefore examine whether the interaction between ClC-3 and endophilin A2 may have a functional effect on the localization of ClC-3 protein in BASMCs. The Ad-mediated endophilin A2 overexpression caused ClC-3 protein expression levels to increase significantly in the cell membrane and decrease in the cytoplasm. Conversely, the knockdown of endophilin A2 caused an increase in ClC-3 protein accumulation in the cytoplasm (Figures 3B,C).

Endophilin A2 facilitated ClC-3 trafficking from the cytoplasm to the plasma membrane in basilar arterial smooth muscle cells (BASMCs). (A) Co-immunoprecipitation analysis of endophilin A2 and ClC-3 protein interaction in cultured BASMCs. (B,C) Western blots analysis of the ClC3 protein in the membrane and cytoplasm from the control BASMCs (con), BASMCs transfecting vector and endophilin A2 adenovirus (Ad-endo2), or BASMCs transfecting negative and endophilin A2 siRNA (endo2siRNA) (n=6, *P<0.05 vs. corresponding controls).

To study if endophilin A2 regulates ClC-3 trafficking and hypotonic-activated Cl.vol ex vivo, we generated transgenic mice that overexpress endophilin A2 (Figures S5A,B). The results from endophilin A2 transgenic mice (endo2 Tg ) support the idea that endophilin A2 facilitates ClC-3 trafficking from the cytoplasm to the plasma membrane in BASMCs. Primary cultures of BASMCs from endo2 Tg showed a much higher level of ClC-3 protein expression at the site of the plasma membrane than in wild type (WT) mice by immunofluorescent staining (Figure 4A). Under the hypotonic condition, Endo2 Tg BASMCs also exhibit a larger Cl.vol than those of age-matched WT mice. The mean current density of Cl.vol was significantly higher in endo2 Tg BASMCs than in the WT group, as shown in Figure 4B (–6.1±1.2 pApF –1 in endo2 Tg vs. –2.7±0.3 pApF –1 in WT, at –100 mV and 19.7±2.7 pApF –1 in endo2 Tg vs. 8.4±1.9 pApF –1 in WT at +100 mV, n=6). There was no significant difference between basal currents in BASMCs from endo2 Tg and WT groups under the isotonic condition (P>0.05). Protože Cl.vol and ClC-3 Cl – currents are critical for VSMC proliferation and cerebrovascular remodeling in hypertension, 6 we then tested whether endophilin A2 affects VSMC proliferation. Figure 4C shows that cultured BASMCs from endo2 Tg had significantly higher proliferation rates compared with those from WT mice in the presence of ET-1 or hypo-osmolarity. However, we did not find a significant difference in the bodyweight and systolic blood pressure between endo2 Tg and WT during the 20 weeks of observation (Figures S5C,D).

ClC-3 is localized at the cytomembrane. Cl.vol and cellular proliferation is increased in basilar arterial smooth muscle cells (BASMCs) from endophilin A2 transgenic mice. (A) Immunofluorescence of ClC-3 in rat BASMCs from endophilin A2 transgenic mice (endo2 Tg ) and their wild-type (WT) littermates. (B) Representative traces of Cl.vol (A), I-V curves (b) and mean current densities measured at ±100 mV (C) in primary cultured BASMCs from wide-type (WT) and endophilin A2 transgenic mice (endo2 Tg ). (n=10, *P<0.05 vs. isotonic WT, # P<0.05 vs. hypotonic WT). (C) CCK-8 cell viability analysis in BASMCs from WT endo2 Tg groups treated with 10 nmol/L ET-1 for 24 h (A) or by hypo-osmolarity for 24 h (b). (n=5, *P<0.05 vs. WT group, # P<0.05 vs. the ET-1-treated or hypotreated WT).

Taken together, it is clear that endophilin A2 may function to enhance ClC-3 protein trafficking from the cytoplasm to the cell membrane, which could be intimately tied to the enhancement of Cl.vol and VSMC proliferation induced by ET-1 and hypo-osmolarity.

SH3 Domain Contributes to Endophilin A2-Mediated ClC-3 Trafficking

All endophilin proteins contain 2 well-documented functional domains: a BAR domain that mediates membrane remodeling, and a C-terminal SH3 domain that serves as protein-recognition modules. Because of the interaction between endophilin A2 and ClC-3 proteins, we hypothesized that some functional domains in endophilin A2 may bind to ClC-3 and mediate its trafficking from the cytoplasm to cell membrane. To test this hypothesis, we constructed 3 endophilin A2 deletion mutants, which failed to induce the function of the: (1) SH3 domain (Endophilin A2-∆SH3) (2) BAR domain (Endophilin A2-∆BAR) and (3) PRD domain (Endophilin A2-∆PRD). Jak je uvedeno v Obrázek 5, co-immunoprecipitation analysis showed that endophilin A2-∆BAR and endophilin A2-∆PRD still had an interaction with ClC-3 however, endophilin A2-∆SH3 exhibited no association with ClC-3. These results indicate that endophilin A2 interacts with the ClC-3 protein through the C-terminal SH3 domain.

Endophilin A2 interacts with ClC-3 by its SH3 domain. A10 cells were co-transfected with pEGFP-C1-ClC-3 and full length Flag-endophilinA2 (A), pEGFP-C1-ClC-3 and Flag-endophilin A2-∆PRD (B), pEGFP-C1-ClC-3 and Flag-endophilin A2-∆SH3 (C), pEGFP-C1-ClC-3 and Flag-endophilin A2-∆BAR (D). Cell lysates were then immunoprecipitated with anti-GFP and probed with anti-Flag and anti-GFP. The normal IgG was used as a control (n=6). (E) Schematic overview of endophilin A2 protein deletion mutants.

To verify whether the SH3 domain of endophilin A2 affects the subcellular distribution of ClC-3 protein, we first isolated the membrane and cytoplasmic protein and found that the membrane ClC-3 expression in endophilin A2 full-length and other deletion mutants groups (Figures 6A,B). We then performed live long-term fluorescence imaging to observe ClC-3 distribution dynamically. When full-length ClC-3 and endophilin A2 cDNAs were co-transfected into A10 cells, ClC-3 protein was found to be gradually recruited into the cell membrane. The transfection of full-length ClC-3 cDNA alone caused the ClC-3 fluorescence to reside mainly in the cytoplasm within the same observation period. Among the endophilin A2 mutants, the ∆PRD and ∆BAR mutants exhibited a similar capability to recruit ClC-3 protein to the plasma membrane whereas the ∆SH3 mutant retained ClC-3 fluorescence in the cytoplasm (Figure S6). We confirmed our findings by detecting the ability of ClC-3 fluorescence recovery after photobleaching (FRAP). A zone near the cell membrane was randomly selected and bleached by a strong excitation beam, where we monitored the capability of FRAP. As we had predicted, endophilin A2 enhanced the fluorescence recovery capability whereas the ∆SH3 mutant abolished this effect (Figure 6C). These results indicate that the SH3 domain is the interacting site between endophilin and ClC-3, which is also essential for trafficking ClC-3 from the cytoplasm to the cell membrane.

The SH3 domain participated in ClC-3 trafficking from the cytoplasm to the cell surface in A10 cells. Western blot analysis of the ClC3 protein in the membrane (A) and cytoplasm (B) from the control basilar arterial smooth muscle cells (BASMCs) (con), BASMCs transfected with a vector, endophilin A2 full length or three deletion mutants (n=6, *P<0.05). (C) Monitoring the fluorescence recovery after photobleaching in the vector and endophilin A2 mutant transfecting groups (n=8, *P<0.01 vs. vector or ∆SH3).

In the present study, we found that ClC-3 protein expression is abundant in the cytosol and the cell membrane of BASMCs, in comparison with previous reports showing that ClC-3 was primarily localized to the cytoplasm in some cell types. We further demonstrated that endophilin A2, an adaptor protein, interacted with ClC-3 through the SH3 domain, enhanced ClC-3 trafficking from the cytoplasm to the surface membrane. We presented several lines of evidence to support the idea that endophilin A2 functions as a new trafficking mechanism regulating ClC-3 and Cl.vol based on the following findings: (1) in BASMCs overexpressing endophilin A2 or from endophilin A2 transgenic mice, we observed a significant increase in both the magnitude of Cl.vol and ClC-3 distribution to the cytoplasmic membrane, which were accompanied by an enhanced ET-1 or hypotonic-induced cell proliferation in BASMCs from transgenic mice, while the Cl.vol activation by hypo-osmolarity and membrane ClC-3 trafficking was inhibited by endophilin A2 siRNA (2) the intracellular dialysis of the anti-endophilin A2 antibody specifically inhibited hypotonic-induced Cl.vol, and co-transfection with ClC-3 siRNA markedly inhibited the large Cl.vol induced by endophilin A2 expression and (3) there is a molecular interaction between endophilin A2 and ClC-3 proteins. By employing 3 endophilin A2 deletion mutants, we found that the SH3 domain is necessary for the interaction between endophilin A2 and ClC-3, as well as for the ClC-3 trafficking between the cytoplasm and cell membrane (Figure 7).

Schematic of endophilin A2 regulation of ClC-3-mediated Cl.vol in vascular smooth muscle cells (VSMCs). ClC-3 is evenly distributed in the cytoplasm and plasma membrane in VSMCs, and intracellular ClC-3 is primarily localized in the endosome and vesicle. Endophilin A2 could bind to ClC-3 by its SH3 domain and modulate ClC-3 trafficking from the cytoplasm to the plasma membrane and stabilize ClC-3 expression on the cell surface, which eventually leads to activation of the ClC-3-mediated swelling-regulated Cl – channel under hypotonic stress.

Endophilins have shown their prominent roles in the processes that require remodeling of the membrane structure. 26 , 27 It is demonstrated that endophilins can sense membrane curvature, form and expose a scaffold and large membrane surface for recruiting specific downstream interacting proteins to the membrane, which are responsible for coupling distinct plasma membrane remodeling to specific biological processes. The endophilin A2-mediated protein trafficking is evoked during the process of cell membrane bending or remodeling. Membrane bending or curvature is commonly induced in VSMCs when exposed to cell shape or volume challenges. It is therefore not surprising here to observe the association between endophilin A2 and ClC-3 during the hypotonic-induced cell volume challenge.

In contrast, a large number of previous studies have documented that ClC-3 is critical for adaptive remodeling in many cell types 28 in response to physiological and pathophysiological stresses associated with osmotic stress or cell volume perturbations, such as vascular smooth muscle reactive oxygen species (ROS) generation 29 and inflammatory responses, 30 , 31 insulin secretion, 32 – 34 VSMC proliferation and hypertensive cerebrovascular remodeling, 6 , 12 and neutrophil infiltration. 9 , 35 , 36 In VSMCs, ClC-3 protein is abundantly expressed and has functionally been associated with Cl.vol during the development of vascular remodeling. However, before the present study, the trafficking of intracellular ClC-3 to the surface membrane upon hypotonic-induced cell swelling or endophilin-A2 overexpression had never been described. An acute cell volume challenge activates Cl.vol and results in the efflux of Cl – , which is essential for the development of hypertensive cerebrovascular remodeling and other pathophysiological processes. These morphological alterations of VSMC under diseased conditions definitely include membrane bending or curvature. By using multiple approaches, we demonstrated here that endophilin A2 interacts with ClC-3 protein to enhance the surface membrane ClC-3 accumulation and upregulate Cl.vol. It is important to note that BASMCs overexpressing endophilin A2 or from endophilin A2 transgenic mice exhibited no change in outward Cl – current and cell viability under the resting state or under isotonic conditions, but have significantly enhanced the Cl.vol and increased the proliferation rate in response to ET-1 or hypo-osmolarity. These results are in agreement with the phenotype of endophilin A2 transgenic mice where there was no abnormality in body weight and systolic blood pressure. That is, endophilin A2 may participate in the activation of Cl.vol during the development of cardiovascular diseases. Our results from a 2-kidney, 2-clip (2k2c) renohypertensive rat model agree with this inference and demonstrated that endophilin A2 protein expression and the surface membrane ClC-3 accumulation in BASMCs from 2k2c hypertensive rats were increased within 4 weeks of operation (unpublished data), which was accompanied by the upregulation of the ClC-3 channel and Cl.vol in vascular SMC proliferation and hypertensive cerebrovascular remodeling. Together, our data indicate that an endophilin A2-associated trafficking abnormality may occur during hypertension, which may contribute to the alteration of ClC-3 function and expressions during the VSMC proliferation and hypertensive vascular remodeling.

N-terminal BAR domain and SH3 domain of endophilins are 2 key players in the regulation of membrane remodeling and reorganization of the protein-protein interaction partners. 37 , 38 The SH3 domains of endophilin recognize and bind to the proline-rich domain (PRD), which is important for endophilin-dynamin interaction 39 and endophilin-ion channel interaction. Our results from mutant analysis demonstrated that it was the SH3 domain of endophilin A2 that interact with ClC-3 and influence subcellular ClC-3 localization to the cell membrane. Whereas the N-BAR domain and PRD were not necessary. There is no PRD in ClC-3, and the ∆PRD mutant showed no effects on the interaction between endophilin A2 and ClC-3 or on the ClC-3 membrane trafficking. It therefore suggests an unknown intermolecular mechanism underlying the SH3-dependent protein-protein interaction in ClC-3 trafficking that is not reliant on PRD-recognition.

In addition to the SH3 domain, several membrane-binding mechanisms have been ascribed to ClC-3 channels, such as Src, phospholipase C-Ins(3,4,5,6) and P4. 40 , 41 Several putative trafficking motifs within ClC-3 were also suggested for ClC-3 trafficking during diverse biological processes. For example, ClC-3 could interact with clathrin and regulate the endocytosis and surface expression of ClC-3. 17 Our recent work has demonstrated that tyrosine 284 phosphorylation targeted by Src is associated with ClC-3 channel activation upon hypotonic stress in VSMCs. 25 , 40 However, the tyrosine phosphorylation signaling appears not to be involved in the endophilin A2-mediated ClC-3 trafficking mechanism, which may be due to their different influences on the subcellular localization of ClC-3. In the basal state, exogenous endophilin A2 transfection could regulate ClC-3 subcellular localization, but it is not the case for tyrosine 284 phosphorylation.

One novel finding here is that we had recorded a larger hypotonic-activated outward Cl – current in BASMCs overexpressing endophilin A2 or from endophilin A2 transgenic mice. The properties of the overexpressed or transgenic endophilin A2 Cl – current were generally similar to those of VRACs. Given that we have a well-established association of ClC-3 with Cl.vol in VSMCs, particularly during the development of hypertension, endophilin A2 may be reasonably interpreted as a new ClC-3 trafficking mechanism for membrane Cl.vol regulation. The ability of ClC-3 siRNA to significantly reduce the endophilin A2-dependent, hypotonic-activated outward Cl – current strengthened this notion in VSMCs. Currently, accumulating evidence has demonstrated that ClC-3 serves as one molecular component involved in the activation or regulation of Cl.vol in VSMCs and some other cell types. 16

As an essential component for outward Cl – current or [Cl – ] in VSMCs, ClC-3 has been well established to play a critical role in vascular inflammatory and proliferative diseases. Our present findings in VSMCs thus provide a potential mechanism for ClC-3 to function as a cell membrane Cl – channel. Another important factor is that different cells exhibit different subcellular distributions of ClC-3, even in resting states, which may be one reasonable explanation for the existence of cell type-specific interdependence of ClC-3 and Cl.vol. In addition, we previously demonstrated that inhibition of ClC-3 expression and Cl.vol contributes to the beneficial effects of simvastatin, which is clinically used for the prevention of a secondary stroke, on BASMC proliferation and vascular remodeling during 2k2c hypertension. 11 Based on the observation that endophilin A2 expression and the surface membrane ClC-3 accumulation in BASMCs were gradually upregulated during the development of hypertension, the present findings suggest that endophilin A2-mediated ClC-3 trafficking may represent an attractive target for pharmacological or therapeutic interventions in vascular remodeling induced by hypertension.

In conclusion, the present study identified the SH3 domain of endophilin A2 as a ClC-3 channel partner, which serves as a new ClC-3 trafficking mechanism regulating Cl.vol in VSMCs. Endophilin A2 may be therefore involved in the development of cardiovascular diseases related to altered ClC-3 signaling (ie, hypertensive cerebrovascular remodeling). In addition, our data provides insight for new investigations of endophilin A2 in physiological and pathological functions of the vascular system.

Y.-Y.G. conceived the study, G.-L.W. wrote the paper, C.-Z.L. designed, performed and analyzed the experimental data. E.-W.H. contributed to the plasmids construction, X.-Y.L., R.-H.D., and M.G. performed live cell imaging. H.-S.S. modified the manuscript. M.-M.M. and F-.Y.L. provided technical assistance. All authors reviewed the results and approved the final version of the manuscript.

This work was supported by the National Natural Science Foundation of China (Key grants No.81230082 and No.81302771, 81302771, 81370897) and the CHINA-CANADA Joint Health Research Initiative Proposal (No. 81361128011).

The authors wish to thank Dr Robert M.K.W. Lee from McMaster University, Canada, for his kind assistance with improving the manuscript.

Obrázek S1. Expression profile of the endophilin A subfamily in rat basilar arterial smooth muscle cells (BASMCs) and brain tissue.

Obrázek S2. Efficiency of endophilin A2 siRNA knockdown and adenovirus (Ad)-mediated endophilin A2 overexpression.

Obrázek S3. Inhibition of a native hypotonic-activated Cl – current in basilar arterial smooth muscle cells (BASMCs) by anti-endophilin A2 antibody intracellular dialysis.

Obrázek S4. Large hypotonic-activated Cl – current induced by adenovirus-mediated endophilin A2 overexpression is ClC-3 dependent.

Obrázek S5. Endophilin A2 in transgenic mice had no effect on body weight and systolic blood pressure compare to its littermate control.

Obrázek S6. The SH3 domain participated in ClC-3 trafficking from the cytoplasm to the cell surface in A10 cells.


A2. Facilitated Diffusion - Biology

Abstraktní

Small molecule drugs target many core metabolic enzymes in humans and pathogens, often mimicking endogenous ligands. The effects may be therapeutic or toxic, but are frequently unexpected. A large-scale mapping of the intersection between drugs and metabolism is needed to better guide drug discovery. To map the intersection between drugs and metabolism, we have grouped drugs and metabolites by their associated targets and enzymes using ligand-based set signatures created to quantify their degree of similarity in chemical space. The results reveal the chemical space that has been explored for metabolic targets, where successful drugs have been found, and what novel territory remains. To aid other researchers in their drug discovery efforts, we have created an online resource of interactive maps linking drugs to metabolism. These maps predict the “effect space” comprising likely target enzymes for each of the 246 MDDR drug classes in humans. The online resource also provides species-specific interactive drug-metabolism maps for each of the 385 model organisms and pathogens in the BioCyc database collection. Chemical similarity links between drugs and metabolites predict potential toxicity, suggest routes of metabolism, and reveal drug polypharmacology. The metabolic maps enable interactive navigation of the vast biological data on potential metabolic drug targets and the drug chemistry currently available to prosecute those targets. Thus, this work provides a large-scale approach to ligand-based prediction of drug action in small molecule metabolism

To submit an update or takedown request for this paper, please submit an Update/Correction/Removal Request.


Hydrolysis of Micellar Phosphatidylcholine Accelerates Cholesterol Absorption in Rats and Caco-2 Cells

Lymphatic recovery of cholesterol infused into the duodenum as bile salt micelles containing phosphatidylcholine (PC) was accelerated by the co-administration of phospholipase A2 in bile and pancreatic juice diverted rats. Previously we observed that cholesterol esterase, which has the ability to hydrolyze PC, caused the same effect under a similar experimental condition (Ikeda et al., Biochim. Biophys. Acta, 1571, 34–44 (2002)). Accelerated cholesterol absorption was also observed when a part of micellar PC was replaced by lysophosphatidylcholine (LysoPC) and oleic acid. Phospholipase A2 facilitated the incorporation of micellar cholesterol into Caco-2 cells in a dose-dependent manner. There was a highly negative correlation between the incorporation of cholesterol into Caco-2 cells and the content of micellar PC remaining in the culture medium. The release of cholesterol as a monomer from bile salt micelles was enhanced when a part of micellar PC was replaced with LysoPC and oleic acid. These results strongly suggest that the release of monomer cholesterol from bile salt micelles is accelerated by hydrolysis of PC in bile salt micelles and hence that cholesterol absorption is enhanced.