Informace

Proč jsou sekvence prokaryotických promotorů psány 5 'až 3', když transkripce probíhá od 3 'do 5'?


Zdá se, že oblasti promotoru jsou zapsány ve směru 5 'až 3'. Moje poznámky z přednášky například uvádějí sekvence promotorových oblastí -35 a -10 takto:

Zdá se, že Wikipedie souhlasí s jejich článkem o promotérech.

RNA polymeráza se však transkribuje ve 3 'až 5', jako v ní čte pramen šablony ve směru 3 'až 5'. Proč v takovém případě nejsou oblasti promotoru zapsány také ve směru 3 'až 5'?

To znamená, místo aby byla sekvence -105'-TATAAT-3 ', proč ne?3'-ATATTA-5 ', ve shodě se směrem transkripce?

Můj intuitivní odhad je, že faktor $ sigma $ rozpoznává oblast promotoru ve směru 5 'až 3'. Ale nemohu najít žádné informace, které by podpořily tento odhad. Navíc, pokud je to pravda, jak to mohlo být určeno (experimentálně)? Kromě toho, ať už je odpověď jakákoli, platí také pro přepis v eukaryotech?


Sekvence DNA podle konvence je zapsána počínaje 5 'pozicí, takže se předpokládá směrovost bez výslovného zápisu 5' a 3 '. Proč to není sekvence řetězce templátu. Řekl bych, že je to také konvence pro jednoduchost, protože stačí napsat jednu sekvenci, pokud chcete diskutovat o genech a regulačních prvcích.


Zahájení transkripce v prokaryotech

Prokaryoty nemají jádra uzavřená v membráně. Procesy transkripce, translace a degradace mRNA proto mohou probíhat současně. Nitrobuněčnou úroveň bakteriálního proteinu lze rychle zesílit vícenásobnými transkripčními a translačními událostmi, ke kterým dochází souběžně na stejném DNA templátu. Prokaryotická transkripce často pokrývá více než jeden gen a produkuje polycistronické mRNA, které specifikují více než jeden protein.

Naše diskuse zde bude příkladem transkripce popisem tohoto procesu v Escherichia coli, dobře studovaný bakteriální druh. Ačkoli mezi přepisem v jazyce existují určité rozdíly E-coli a přepis v archea, porozumění E-coli transkripci lze aplikovat prakticky na všechny bakteriální druhy.


Biologie 171

Na konci této části budete moci provést následující:

  • Uveďte různé kroky v prokaryotické transkripci
  • Diskutujte o roli promotorů v prokaryotické transkripci
  • Popište, jak a kdy je transkripce ukončena

Prokaryoty, které zahrnují bakterie a archaea, jsou většinou jednobuněčné organismy, které podle definice postrádají jádra vázaná na membránu a další organely. Bakteriální chromozom je uzavřený kruh, který na rozdíl od eukaryotických chromozomů není organizován kolem histonových proteinů. Centrální oblast buňky, ve které sídlí prokaryotická DNA, se nazývá oblast nukleoidů. Kromě toho mají prokaryoty často hojné plazmidy, což jsou kratší kruhové molekuly DNA, které mohou obsahovat pouze jeden nebo několik genů. Plasmidy mohou být během buněčného dělení přenášeny nezávisle na bakteriálním chromozomu a často nesou takové rysy, jako jsou ty, které mají rezistenci na antibiotika.

Transkripce v prokaryotech (a v eukaryotech) vyžaduje dvojitou šroubovici DNA, aby se částečně uvolnila v oblasti syntézy mRNA. Oblast odvíjení se nazývá transkripční bublina. Transkripce vždy probíhá ze stejného řetězce DNA pro každý gen, který se nazývá templátový řetězec. Produkt mRNA je komplementární k templátovému vláknu a je téměř identický s jiným řetězcem DNA, nazývaným nešablonové vlákno nebo kódující vlákno. Jediným rozdílem nukleotidů je, že v mRNA jsou všechny T nukleotidy nahrazeny U nukleotidy ((obrázek)). V dvojité šroubovici RNA se A může vázat na U dvěma vodíkovými vazbami, stejně jako při párování A -T v dvojité šroubovici DNA.


Nukleotidový pár ve dvojšroubovici DNA, který odpovídá místu, ze kterého je transkribován první nukleotid 5 ′ mRNA, se nazývá místo +1 nebo iniciační místo. Nukleotidy předcházející iniciačnímu místu jsou označeny „-“ a jsou označeny upstream nukleotidy. Naopak nukleotidy následující po iniciačním místě jsou označeny číslem „+“ a jsou nazývány downstream nukleotidy.

Zahájení transkripce v prokaryotech

Prokaryoty nemají jádra uzavřená v membráně. Procesy transkripce, translace a degradace mRNA proto mohou probíhat současně. Nitrobuněčnou úroveň bakteriálního proteinu lze rychle zesílit vícenásobnými transkripčními a translačními událostmi, ke kterým dochází souběžně na stejném templátu DNA. Prokaryotické genomy jsou velmi kompaktní a prokaryotické transkripty často pokrývají více než jeden gen nebo cistron (kódující sekvence pro jeden protein). Polycistronické mRNA jsou poté translatovány za vzniku více než jednoho druhu proteinu.

Naše diskuse zde bude příkladem transkripce popisem tohoto procesu v Escherichia coli, dobře studovaný druh eubakterie. Ačkoli mezi přepisem v jazyce existují určité rozdíly E-coli a přepis v archea, porozumění E-coli transkripci lze aplikovat prakticky na všechny bakteriální druhy.

Prokaryotická RNA polymeráza

Prokaryoty používají stejnou RNA polymerázu k přepisu všech svých genů. v E-coliPolymeráza se skládá z pěti polypeptidových podjednotek, z nichž dvě jsou identické. Čtyři z těchto podjednotek, označeny α, α, β, a β‘, obsahují polymerázový jádrový enzym. Tyto podjednotky se shromažďují pokaždé, když je přepisován gen, a po dokončení transkripce se rozloží. Každá podjednotka má svou jedinečnou roli α-podjednotky jsou nezbytné k sestavení polymerázy na DNA β-podjednotka se váže na ribonukleosid trifosfát, který se stane součástí rodící se molekuly mRNA a βPodjednotka ‘ váže vlákno templátu DNA. Pátá podjednotka, σ, se podílí pouze na zahájení transkripce. Uděluje transkripční specificitu tak, že polymeráza začne syntetizovat mRNA z vhodného iniciačního místa. Bez σ, jádrový enzym by se přepisoval z náhodných míst a produkoval by molekuly mRNA, které specifikovaly proteinový blábol. Polymeráza složená ze všech pěti podjednotek se nazývá holoenzym.

Prokaryotičtí promotéři

Promotor je sekvence DNA, na kterou se transkripční aparát, včetně RNA polymerázy, váže a iniciuje transkripci. Ve většině případů existují promotory před geny, které regulují. Specifická sekvence promotoru je velmi důležitá, protože určuje, zda je odpovídající gen transkribován po celou dobu, někdy nebo zřídka. Ačkoli se promotory u prokaryotických genomů liší, několik prvků je u mnoha druhů evolučně konzervováno. V oblastech -10 a -35 proti proudu od iniciačního místa jsou dva konsensuální sekvence promotorunebo oblasti, které jsou podobné napříč všemi promotory a napříč různými bakteriálními druhy ((obrázek)). Sekvence -10, nazývaná oblast -10, má konsensuální sekvenci TATAAT. Sekvence -35 má konsensuální sekvenci TTGACA. Tyto konsensuální sekvence jsou rozpoznávány a vázány σ. Jakmile je tato interakce provedena, podjednotky jádrového enzymu se vážou na místo. Oblast -10 bohatá na A -T usnadňuje odvíjení templátu DNA a je vytvořeno několik fosfodiesterových vazeb. Fáze zahájení transkripce končí produkcí abortivních transkriptů, což jsou polymery přibližně 10 nukleotidů, které jsou vytvořeny a uvolněny.


V části Transcription (video – Walter & amp Eliza Hall) uvidíte první část transkripce a opakování základní sekvence pole TATA.

Prodloužení a ukončení v prokaryotech

Fáze prodloužení transkripce začíná uvolněním σ podjednotku z polymerázy. Disociace σ umožňuje jádrovému enzymu postupovat podél DNA templátu, syntetizovat mRNA ve směru 5 ′ až 3 ′ rychlostí přibližně 40 nukleotidů za sekundu. Jak postupuje prodloužení, DNA se kontinuálně odvíjí před jádrovým enzymem a přetáčí se za ním. Párování bází mezi DNA a RNA není dostatečně stabilní, aby udrželo stabilitu složek syntézy mRNA. Místo toho RNA polymeráza působí jako stabilní spojovací článek mezi templátem DNA a rodícími se vlákny RNA, aby bylo zajištěno, že prodloužení není předčasně přerušeno.

Prokaryotické ukončovací signály

Jakmile je gen přepsán, musí být prokaryotická polymeráza instruována, aby se oddělila od templátu DNA a uvolnila nově vytvořenou mRNA. V závislosti na transkribovaném genu existují dva druhy terminačních signálů. Jeden je na bázi bílkovin a druhý na bázi RNA. Ukončení závislé na Rho je řízeno proteinem rho, který sleduje podél polymerázy na rostoucím řetězci mRNA. Blízko konce genu polymeráza narazí na běh G nukleotidů na DNA templátu a zastaví se. Výsledkem je, že rho protein koliduje s polymerázou. Interakce s rho uvolňuje mRNA z transkripční bubliny.

Rho-nezávislé ukončení je řízeno specifickými sekvencemi v řetězci DNA templátu. Jak se polymeráza blíží konci transkribovaného genu, narazí na oblast bohatou na C – G nukleotidy. MRNA se složí zpět na sebe a komplementární C -G nukleotidy se spojí. Výsledkem je stabilní vlásenka, která způsobí zastavení polymerázy, jakmile začne přepisovat oblast bohatou na A -T nukleotidy. Komplementární oblast U – A transkriptu mRNA tvoří pouze slabou interakci s templátovou DNA. To ve spojení se zastavenou polymerázou vyvolává dostatečnou nestabilitu, aby se jádrový enzym mohl odlomit a uvolnit nový transkript mRNA.

Po ukončení je proces přepisu dokončen. V době, kdy dojde k ukončení, by již byl prokaryotický transkript použit k zahájení syntézy mnoha kopií kódovaného proteinu, protože tyto procesy mohou probíhat souběžně. Sjednocení transkripce, translace a dokonce degradace mRNA je možné, protože všechny tyto procesy probíhají ve stejném směru 5 ′ až 3 ′, a protože v prokaryotické buňce neexistuje membránová kompartmentalizace ((obrázek)). Naproti tomu přítomnost jádra v eukaryotických buňkách vylučuje simultánní transkripci a translaci.


Podívejte se na Transcription (video – ndsuvirtualcell) a podívejte se na proces prokaryotické transkripce.

Shrnutí sekce

U prokaryot je syntéza mRNA zahájena v promotorové sekvenci na DNA templátu obsahující dvě konsensuální sekvence, které rekrutují RNA polymerázu. Prokaryotická polymeráza se skládá z jádrového enzymu čtyř proteinových podjednotek a σ protein, který pomáhá pouze při zahájení. Elongace syntetizuje mRNA ve směru 5 ′ až 3 ′ rychlostí 40 nukleotidů za sekundu. Ukončení uvolňuje mRNA a probíhá buď interakcí rho proteinu, nebo vytvořením vlásenky mRNA.

Odpověď zdarma

Pokud je mRNA komplementární k vláknu templátu DNA a vlákno templátu DNA je komplementární k řetězci DNA bez šablony, proč nejsou sekvence bází mRNA a řetězce DNA bez templátu totožné? Mohli by někdy být?

DNA se liší od RNA v tom, že T nukleotidy v DNA jsou nahrazeny U nukleotidy v RNA. V sekvenci bází proto nikdy nemohou být identické.

Popište svými slovy rozdíl mezi ukončením transkripce v prokaryotech závislým na rho a nezávislým na rho.

Ukončení závislé na Rho je řízeno proteinem rho, který sleduje podél polymerázy na rostoucím řetězci mRNA. Blízko konce genu se polymeráza zastaví při běhu G nukleotidů na DNA templátu. Protein rho koliduje s polymerázou a uvolňuje mRNA z transkripční bubliny. Rho-nezávislé ukončení je řízeno specifickými sekvencemi v řetězci DNA templátu. Jak se polymeráza blíží konci transkribovaného genu, narazí na oblast bohatou na C – G nukleotidy. To vytvoří vlásenku mRNA, která způsobí zastavení polymerázy, když začne přepisovat oblast bohatou na A -T nukleotidy. Protože vazby A – U jsou méně termostabilní, jádrový enzym odpadává.

Fragment bakteriální DNA zní:

3 ‘–TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5‘

Za předpokladu, že tento fragment je templátový řetězec, jaká je sekvence mRNA, která by byla transkribována? (Tip: Nezapomeňte identifikovat iniciační web.)

Zkoumáním sekvence DNA můžeme vidět, že v blízkosti 3 'konce fragmentu je konsensuální sekvence -10. Pokud pak počítáme po proudu, iniciační místo +1 je T bezprostředně následující za sekvencí AAT. To znamená, že fragment DNA, který bude sloužit jako templát pro transkripci, má sekvenci TGATAGAAGCACTCTAC. MRNA vyrobená z této šablony bude mít bezplatné párování bází s uracilem (U) místo tyminu (T). To nám dává ACUAUCUUCGUGAGAUG jako transkribovanou sekvenci mRNA.

Glosář


Studijní poznámky k přepisu v prokaryotech | Buněčná biologie

V prokaryotických organismech dochází k transkripci ve třech fázích známých jako iniciace, elon & shygace a ukončení pomocí jednoduché RNA polymerázy.

RNA je syntetizována jediným enzymem RNA polymerázy, který obsahuje více polypeptidových podjednotek.

V E. coli má RNA polymeráza pět podjednotek:

dvě a, jedna p, jedna P ’ a jedna podjednotka (α2ββ’σ). Tato forma se nazývá holoenzym. Podjednotka σ se může odpojit od ostatních podjednotek a zanechat formu známou jako jádrový enzym.

Tyto dvě formy RNA polymerázy mají různé role v transkripci. Podjednotka σ je vyžadována pro inter & shyaction s faktorem sigma. Faktor sigma rozpoznává počáteční signál DNA a řídí vazbu enzymu na iniciační místo na templátu DNA. Vazba RNA polymerázy na DNA zahrnuje beta podjednotku.

Iniciace zahrnuje vazbu RNA polymerázy na místo promotoru.

Stránky promotéra pro zahájení:

Transkripce nemůže začít náhodně, ale musí začít speciálně na začátku genu. Signály pro zahájení transkripce se vyskytují v promotorové sekvenci, která leží přímo proti směru transkribované sekvence genu.

Promotor obsahuje specifické sekvence DNA, které působí jako body připojení RNA polymerázy. Přesné sekvence se mohou mezi promotory lišit, ale jsou v souladu s celkovým vzorcem známým jako konsensuální sekvence.

V E. Coli jsou dva sekvenční prvky, -10 sekvence a -35 sekvence, rozpoznávány RNA polymerázou. Sekvence consen & shysus -10, také nazývaná “ Síťový box ” je TATAAT a konsensuální sekvence -35, také nazývaná “ sekvence rozpoznávání ” je TTGACA. (Obr. 16.2).

Podjednotka σ RNA polymerázy je zodpovědná za rozpoznávání a vazbu promotoru, pravděpodobně v -35 boxu. V nepřítomnosti podjednotky σ se enzym stále může vázat na DNA, ale vazba je náhodnější.

Zahájení syntézy RNA:

Když se enzym váže na promotor, zpočátku vytvoří uzavřený komplex promotoru, ve kterém DNA promotoru zůstává jako dvojitá šroubovice. Enzym pokrývá asi 60 párů bází promotoru včetně boxů -10 a -35.

Aby mohl trans & shycription začít, dvojitá šroubovice se částečně disociuje v boxu -10, který je bohatý na slabé vazby A -T, za vzniku otevřeného komplexu promotoru. Podjednotka σ se poté disociuje z otevřeného komplexu promotoru a opouští jádrový enzym. Současně se první dva ribonukleotidy vážou na DNA, vytvoří se první fosfodiesterová vazba a zahájí se transkripce (obr. 16.3).

Během prodloužení se RNA polymeráza pohybuje podél molekuly DNA, taje a odvíjí dvojitou šroubovici, jak postupuje. Enzym přidává ribonukleotidy na konec 3 ′ rostoucí molekuly RNA s pořadím adice určeným podle pořadí bází na templátovém řetězci.

Ve většině případů je vedoucí sekvence proměnné délky transkribována před dosažením kódující sekvence genu. Podobně na konci kódující sekvence je nekódující sekvence přívěsu trans -shykována před koncem transkripce. Během trans & shycription je v každém okamžiku odvinuta pouze malá část dvojité šroubovice.

Odvinutá oblast obsahuje nově syntetizovanou RNA bázi spárovanou s templátovým řetězcem DNA a zasahuje do 12-17 bází. Odvinutá oblast musí zůstat malá, protože odvíjení v jedné oblasti vyžaduje navíjení v přilehlých oblastech a to způsobuje napětí na molekulu DNA.

Abychom tomuto problému zabránili, je RNA uvolněna z templátové DNA, jak je syntetizována, což umožňuje reformu dvojité šroubovice DNA (obr. 16.4).

Prodloužení řetězce probíhá přidáním aktivovaných ribonukleosid trifosfátů (ATP, UTP, GTP a CTP) do jednoho vlákna DNA templátu. Pro každý nukleotid přidaný do rostoucího řetězce RNA se uvolňuje pyrofosfát (PPi). To se rychle hydrolyzuje na anorganický fosfát a shyfát (Pi).

Syntéza řetězce RNA je napájena výdejem energie ve formě pyrofosfátů. Na každý přidaný mono & shymer nukleotidů do řetězce jsou vynaloženy dva vysoce energetické fosfáty a shyfáty.

Celá reakce může být shrnuta následovně:

K prodloužení řetězce RNA dochází pomocí jádrového enzymu, který se pohybuje podél templátu DNA. Během transkripce je RNA syntetizována polymerací ribonových a shycleotid trifosfátových podjednotek (ATP, UTP, GTP, CTP).

3 ′-OH jednoho ribonukleotidu reaguje s 5 ′ fosfátem jiného za vzniku fosfodiesterové vazby. Přepis je syntetizován a uspořádán ve směru 5 ′ → 3 ′, ale protože řetězec musí být pro párování bází antiparalelní, vlákno šablony běží v opačném směru, 3 ’ → 5 ′.

Řetězy RNA rostou v 5 ’ → 3 ′ Směr:

Pokud jsou řetězce RNA syntetizovány ve směru 5 ’ → 3 ′, pak by první nukleotid měl mít trifosfátovou skupinu (P

P). Pokud naopak řetězec roste ve směru 3 ’ → 5 ′, pak by trifosfátová skupina byla na nukleotidu na rostoucím konci. Bylo zjištěno, že trifosfátová skupina je připojena k prvnímu nukleotidu na jeho konci 5 ′ a volná hydroxylová skupina na konci 3 ′.

To ukazuje, že růst probíhá ve směru 5 ′ → 3 ′.

Pouze jeden DNA řetězec genu přepisuje mRNA:

V dvouvláknové DNA je daný gen transkribován z jednoho ze dvou řetězců. Přepisovaná RNA je komplementární pouze k jednomu ze dvou řetězců. Všechny přepsané geny však nemusí být na jednom vlákně dvojité šroubovice DNA.

Jeden gen může transkribovat mRNA z jednoho vlákna, zatímco jiný transkribuje z druhého vlákna. Tyto dva prameny nebo dvojitá šroubovice se nazývají šablony a vlákna bez šablony. RNA se produkuje pomocí templátového vlákna a syntetizovaná a shysizovaná molekula RNA je kopií řetězce bez templátu (obr. 16.5), nazývaného také sense (+) vlákno nebo kódující vlákno. Syntetizovaná molekula RNA se nazývá transkript.

K ukončení transkripce a shytion dochází náhodně a trvá ve specifických bodech po konci kódující sekvence. V E. coli dochází k ukončení v sekvencích známých jako palindromy. Ty jsou symetrické kolem svého středu tak, že v první polovině sekvence následuje její přesný doplněk ve druhé polovině.

V jednovláknových molekulách RNA umožňuje tato funkce první polovině sekvence párovat bází s druhou polovinou za vzniku struktury známé jako kmenová smyčka (obr. 16.6). Zdá se, že fungují jako signály pro ukončení a styky. V některých případech po sekvenci kmenové smyčky následuje běh 5-10. Stejně jako v DNA, která tvoří slabé páry A-U bází s nově syntetizovanou a syntetizovanou RNA.

Má se za to, že RNA poly & shymerasa se zastaví těsně za kmenovou smyčkou a že se slabé páry A-U bází rozbijí, což způsobí odpojení trans & shycriptu od šablony.

V jiných případech běh As chybí a dochází k odlišnému mechanismu založenému na vazbě proteinu zvaného Rho (p), který narušuje párování bází mezi tem & shyplate a transkriptem, když se polymeráza zastaví po kmenové smyčce. Ukončení transkripce zahrnuje uvolnění transkriptu a jádrového enzymu, který se pak může znovu spojit s podjednotkou o a přejít na další kolo transkripce.


Prodloužení

Jak postupuje prodloužení, DNA se kontinuálně odvíjí před jádrovým enzymem, protože vodíkové vazby, které spojují komplementární páry bází v dvojité šroubovici DNA, jsou přerušeny (obrázek 2). Při reformě vodíkových vazeb se DNA přetáčí za jádrovým enzymem. Párování bází mezi DNA a RNA není dostatečně stabilní, aby udrželo stabilitu složek syntézy mRNA. Místo toho RNA polymeráza působí jako stabilní spojovací článek mezi templátem DNA a nově se tvořícím řetězcem RNA, aby bylo zajištěno, že prodloužení není předčasně přerušeno.

Obrázek 2 Během prodlužování RNA polymeráza sleduje podél DNA templátu, syntetizuje mRNA ve směru 5 ′ až 3 ′ a odvíjí se a poté převine DNA, jak je čtena.


Prokaryotické ukončovací signály

Jakmile je gen přepsán, musí být prokaryotická polymeráza instruována, aby se oddělila od templátu DNA a uvolnila nově vytvořenou mRNA. V závislosti na transkribovaném genu existují dva druhy terminačních signálů. Jeden je na bázi bílkovin a druhý na bázi RNA. Ukončení závislé na Rho je řízeno proteinem rho, který sleduje podél polymerázy na rostoucím řetězci mRNA. Blízko konce genu polymeráza narazí na běh G nukleotidů na DNA templátu a zastaví se. Výsledkem je, že rho protein koliduje s polymerázou. Interakce s rho uvolňuje mRNA z transkripční bubliny.

Rho-nezávislé ukončení je řízeno specifickými sekvencemi v řetězci DNA templátu. Jak se polymeráza blíží konci transkribovaného genu, narazí na oblast bohatou na C – G nukleotidy. MRNA se složí zpět na sebe a komplementární C -G nukleotidy se spojí. Výsledkem je stabilní vlásenka, která způsobí zastavení polymerázy, jakmile začne přepisovat oblast bohatou na A -T nukleotidy. Komplementární oblast U – A transkriptu mRNA tvoří pouze slabou interakci s templátovou DNA. To ve spojení se zastavenou polymerázou vyvolává dostatečnou nestabilitu, aby se jádrový enzym mohl odlomit a uvolnit nový transkript mRNA.

Po ukončení je proces přepisu dokončen. V době, kdy dojde k ukončení, by již byl prokaryotický transkript použit k zahájení syntézy mnoha kopií kódovaného proteinu, protože tyto procesy mohou probíhat souběžně. Sjednocení transkripce, translace a dokonce degradace mRNA je možné, protože všechny tyto procesy probíhají ve stejném směru 5 ′ až 3 ′, a protože v prokaryotické buňce neexistuje membránová kompartmentalizace ([odkaz]). Naproti tomu přítomnost jádra v eukaryotických buňkách vylučuje simultánní transkripci a translaci.



Navštivte tuto animaci BioStudio a podívejte se na proces prokaryotické transkripce.


Přehled přepisu

Transkripce je první fází exprese genů do proteinů. Při transkripci je meziprodukt mRNA (messenger RNA) transkribován z jednoho z řetězců molekuly DNA. RNA se nazývá messenger RNA, protože nese „zprávu“ neboli genetickou informaci z DNA do ribozomů, kde se informace používají k výrobě proteinů. RNA a DNA používají komplementární kódování, kde se páry bází shodují, podobně jako se vlákna DNA vážou za vzniku dvojité šroubovice.

Jeden rozdíl mezi DNA a RNA spočívá v tom, že RNA používá místo thyminu použitého v DNA uracil. RNA polymeráza zprostředkovává výrobu řetězce RNA, který doplňuje řetězec DNA. RNA je syntetizována ve směru 5 ' -> 3' (jak je patrné z rostoucího transkriptu RNA). Existuje několik korekturních mechanismů pro transkripci, ale není jich tolik jako pro replikaci DNA. Někdy se vyskytnou chyby v kódování.


1. Úvod

Tempo, jakým jsou sekvenovány celé genomy, je daleko před tempem anotace sekvence genomu, natož molekulárním chápáním organizace genomu. Ve srovnání s experimentálními přístupy nabízejí výpočetní nástroje rychlejší možnost spolehlivosti anotací sekvencí, o nichž do značné míry rozhoduje jejich pečlivý design, který zase závisí na spravedlivém porozumění dotyčným molekulárním mechanismům.

Jedním z nejvyhledávanějších úkolů v anotaci genomu je identifikace promotorových oblastí, a to nejen pro validaci predikovaných genů a identifikaci nových genů, ale také pro pochopení transkriptomických regulačních sítí (s ohledem na umístění promotoru a architekturu). Během počátečních let akumulace sekvence byla identifikace promotoru považována za nějaký triviální úkol kvůli určitým experimentálně odvozeným pravidlům informace o sekvenci (Pribnow, 1975). Každý rok se však ukázal jako jedna z nejděsivějších výzev v anotaci genomu. Genomické sekvence v prokaryotech jsou vysoce adaptivní v genomech a jsou velmi rozmanité napříč druhy, aby umožnily jejich přežití v různých a extrémních podmínkách. To ztěžuje detekci konzervovaných regulačních míst sekvenční homologií. Dále variabilita v délce 5 'netranslatovaných oblastí a přítomnost více startovních míst transkripce (TSS) neznamená, že je zřejmé hledat promotory v bezprostřední upstream oblasti anotované kódující sekvence. Složitost je dále umocněna vysokou hustotou genů, přičemž sousední geny mají obecně velmi krátké intergenové prostory nebo v některých případech mají překrývající se kódující oblasti. Nedávné zprávy o všudypřítomné transkripci, kde transkripci lze zahájit z jakéhokoli místa, ještě více prohloubily tajemství (Wade a Grainger, 2014).

Bylo vyvinuto mnoho úsilí pro vývoj efektivních nástrojů pro predikci promotorů, založených na různých logikách. Sekvenční výpočetní metody pro predikci promotoru byly středně úspěšné (Dekhtyar a kol., 2008 Jacques a kol., 2006), ačkoli strojové učení na obrovských tréninkových datech promotorových sekvencí vedlo k některým dobrým prediktivním, ale vysoce genomově specifickým nástrojům (de Jong a kol., 2012 de Silva a kol., 2011 Lai a kol., 2019 Shahmuradov a kol., 2016 Solovyev a Salamov, 2011 Umarov a Solovyev, 2017 Umesh a kol.(2014). V poslední době se také věnuje pozornost zachycení strukturálních a/nebo energetických signálů promotorových oblastí. Některé ze strukturních a/nebo energetických vlastností použitých pro predikci promotoru jsou ohebnost, zakřivení, vlastnosti mezi párem bází (BP), volná energie, A-philicity a stresem indukovaná duplexní destabilizace DNA mimo jiné (Abeel a kol., 2008 Florquin a kol., 2005 Goñi a kol., 2007 Rangannan a Bansal, 2010 Wang a Banham, 2006). Bylo zjištěno, že tvar DNA určený čtyřmi odlišnými rysy - menší šířkou háje, zkroucením vrtule, válcováním a šroubovicí - je důležitým determinantem při identifikaci vazebných míst transkripčního faktoru (TFB) a TSS (Chiu) a kol., 2015 Levo a kol., 2015 Zhou a kol.(2013, 2015). Tyto studie nepochybně prokazují, že trojrozměrná struktura DNA přesahující primární sekvenci je determinantem vazebné specificity protein – DNA. Navzdory mnoha poznatkům vyplývajícím z takovýchto studií v průběhu let se stále čeká na vývoj nástroje pro predikci promotoru poskytujícího vysoký výkon. Je zřejmé, že existující koncepční rámce zatím nejsou dostatečné k tomu, aby plně porozuměly povaze promotorových signálů. Existuje potřeba vyvinout nové nápady/modely k vysvětlení jemného doladění strukturálního a energetického stavu promotorové sekvence s ohledem na interakci protein/transkripční faktory/ligandy.

Odůvodnění: cílem bylo vyvinout nový model pro zachycení strukturálního a energetického stavu promotorů. Pro strukturální charakterizaci jsme se místo získávání tvaru DNA (kumulativní účinek různých parametrů) rozhodli použít všechny jednotlivé parametry (celkem 28) zapojené do prostorové organizace základen a kroků BP-organizace páteře, uspořádání mezi BP, uspořádání uvnitř TK a relativní umístění vzhledem k ose TK. Důvodem měl být široký horizont pro nalezení nových informací. Strukturální analýza byla vedena některými průlomovými studiemi v analýze struktur nukleových kyselin během několika posledních desetiletí (Beveridge a kol., 2004, 2012 Dixit a kol., 2005 Hassan a Calladine, 1995 Lavery a kol., 2009, 2010 Olson a kol., 1998 Pasi a kol., 2014 Yanagi a kol., 1991). Při charakterizaci energie jsme vycházeli z vlastní zkušenosti. V posledních 15 letech jsme se snažili porozumět jazyku DNA z hlediska jeho energetiky a dosáhli jsme skromného úspěchu v tomto procesu. V této sérii jsme uvedli, že energie vodíkových vazeb, stohování a solvatace vykazují jasné podpisy funkčních osudů sekvencí DNA (Dutta a kol., 2006 Khandelwal a kol., 2012, 2014 Khandelwal a Bhyravabhotla, 2010 Khandelwal a Jayaram, 2012 Singh a kol., 2017 Singhal a kol.(2008). Takže s 31 parametry (20 strukturálních a 3 energie) jsme charakterizovali 16 519 primárních sekvencí prokaryotického promotoru (Mishra a kol., 2018). Bylo zjištěno, že všechny parametry poskytují signální signál na/poblíž TSS a informace pro tento signální signál jsou integrovány v sekvencích promotoru. Síla přesného modelu spočívá nejen v jeho schopnosti vysvětlit, ale také předvídat přesně. Pokud je tento strukturní a energetický model promotorů přesný, měl by vést ke spolehlivému nástroji pro predikci promotoru s neobvyklou schopností efektivně a přesně předpovídat prokaryotické promotory bez ohledu na genom/druh. Za tímto účelem jsme nasměrovali naše úsilí vyvinout vhodný algoritmus predikce promotoru z 31 parametrů pomocí různých statistických technik. Zde představujeme novou metodu, SEProm, který je použitelný pro všechny prokaryoty včetně archea a který si ve srovnání s dostupnými programy predikce promotoru vede velmi dobře. Nástroj je volně stažitelný se snadno dodržovatelnými pokyny.


Proč jsou sekvence prokaryotických promotorů psány 5 'až 3', když transkripce probíhá od 3 'do 5'? - Biologie

Co je to gen? Na jedné úrovni je gen uspořádaným řetězcem nukleotidů, který kóduje polypeptid. Takové geny jsou „strukturální“ geny. Víme také, že geny mohou také kódovat RNA, včetně messengerové RNA (mRNA), transferové RNA (tRNA), ribozomální RNA (rRNA) a dalších typů RNA. Ale něco musí zapnout a ukončit genovou expresi a také ji regulovat. Regulační sekvence, kterými mohou být "promotory" nebo "zesilovače/tlumiče", mohou být umístěny daleko od kódujících oblastí. Náš pohled na gen tedy nyní musí zahrnovat myšlenku oddělených oblastí chromozomu. Co když informace přepsaná na mRNA neodráží konečný protein, dokud není dále upravována? Toto je & quot; posttranskripční modifikace & quot. Nyní je koncept genu ještě více zakalený. Co když existují „překrývající se“ kódující oblasti? Je jasné, že naše definice genu nebude jednoduchá.

Funkčně však můžeme popsat gen jako gen, který má odlišnou kódující oblast a odlišnou regulační oblast, přičemž druhá kontroluje rychlost, jakou je DNA transkribována do mRNA. Uvidíme, že regulační jednotky jsou složeny z „motivů“ DNA a že každý motiv bude muset být obsazen regulačním protein má -li být gen řádně regulován. Nejenže musí existovat vhodné uchycení proteinu, ale všechny proteiny musí do sebe zapadat s proteiny vázajícími se na jiné blízké motivy tak, aby kousky skládačky do sebe zapadaly. A existuje jen jeden správný způsob, jak všechno do sebe zapadá. Nejde tedy jen o jednoduchou záležitost syntézy mRNA usměrňující DNA, která pak řídí syntézu proteinů. Proteiny jsou vnitřně zapojeny do regulace produkce proteinů na úrovni transkripce. To může být noční můra, pokud začnete přemýšlet o regulaci produkce regulačních proteinů.

Musíme také vzít v úvahu důležitý rozdíl mezi eukaryoty a prokaryoty, pokud jde o transkripci strukturních nebo proteinově kódujících genů. V eukaryotech jsou geny přepisovány jednotlivě, zatímco v prokaryotech mohou být geny se souvisejícími funkcemi (& quot ;operoperony & quot;) přepisovány společně. As an example, the Lac operon includes three protein-encoding genes as well as their control sequences. The operon is transcribed as a single unit as a "polycistronic mRNA". Eukaryotic structural genes are transcribed as monocistronic mRNA.

DNA-Directed RNA Synthesis

There are three steps that characterize DNA-directed RNA synthesis:

(1) Initiation by binding of the transcription apparatus to the DNA template

(2) Elongation of the mRNA chain

(3) Termination of the mRNA chain

The piece of mRNA that results from the direct transcription of the DNA that encodes a "gene" is called the "primary transcript" and it undergoes modification, sometimes quite extensively, before it can translate its message into protein.

The class of enzymes that synthesize RNAs are known as RNA polymerases. They are all multisubunit complexes that are present in all cells and they catalyze the reaction:

(RNA)n residues + 1 NTP === (RNA)n+1 residues + PP

Pyrophosphate is irreversibly hydrolyzed to 2 P thus driving the reaction to the right. The individual nucleotides that are read off of the DNA template strand are transcribed into the nucleotides of the corresponding RNA, so the final result is a single-stranded polymer, namely the mRNA, whose nucleotides correspond exactly to the complementary nucleotides on the DNA strand with the exception that everywhere that a "A" appears in the DNA template strand, a "U" appears in the mRNA. (The possible NTPs, then, are ATP,CTP,GTP,UTP.)

Transcription in Prokaryotes

The most studied RNA polymerase is that from E-coli, so we will study it as the prototype of the RNA polymerases. The holoenzyme is a 449 kD protein composed of a "core enzyme" and a " s -subunit", and the entire complex is denoted (core) s. The core enzyme directs the polymerization reaction, and it has 4 subunits: core enzyme = a2bb ' w. T he inorganic ions Zn 2+ (two of them in the b ' subunit) and Mg 2+ are required for catalytic activity and the three-dimensional structure of the enzyme resembles a hand. The thumb of the hand can be envsioned as grasping a piece of B DNA that lies in a channel represented by the curved fingers and palm of the hand. This channel is cylindrical, with dimensions on the order of 25 A by 55 A. These dimensions allow a fit of about 16 base pairs of B DNA.

The "hand" structure appears in other enzymes that we will study, including DNA polymerase and reverse transcriptase. You can further study the hand structure of RNA polymerase by looking at T7 RNA polymerase (see PDB below).

We will look at transcription from the point of view of the gene, which we have already mentioned is a rather ambiguous entity. Nevertheless, it is clear that there must be a starting point for correct transcription to take place, and it is reasonable to include this as part of the gene, even though it does not get transcribed itself. So, the problem of initiation is really one of recognition of a starting point. But which of the two strands of the DNA serves as the template and how does the polymerase choose?

Either strand can serve as the template but the transcription always proceeds from the 5' end of a strand of DNA to the 3' end. The 3'-5' strand that serves as the template is called the "antisense" or noncoding strand and the 5'-3' strand (which has the same nucleotide sequence, with exception of "U"s for "T"s, as the subsequently transcribed mRNA) is the "sense" or "coding" strand. To be consistent and clear, we will use the convention that our description of position along a sequence of nucleotides will be from the point of view of the sense strand, as this is the same ordering as that of the mRNA that is transcribed. The part of the gene that serves as the initiation site is called the "promoter" and it is sought out by the RNA polymerase holoenzyme. The holoenzyme binds weakly to DNA, with a Kdissoc of about 10 -7 M, and this allows it to move along the antisense strand in search of the promoter. The s subunit is specific for its promoter sequence and tight binding of the holoenzyme occurs (Kdissoc of about 10 -14 M).

The promoter is recognized by an approximately 40 bp nucleotide sequence on the 5' side of the initiation site, and within this sequence are two "conserved" sequences. One of these is 6 bp in length and is centered about 10 bps upstream from the starting site of transcription. This is the "Pribnow Box" and it has a consensus sequence TATAAT . The other, less highly conserved, sequence is centered about 35 bp upstream and has a consensus sequence of TTGACA . The start site is indicated by the notation +1 and is almost always A nebo G .

RNA polymerase holoenzyme contacts the promoter at roughly the centers of the two regions (-10 and -35) and the core enzyme tightly binds to the duplex DNA. Its action is that of melting the double-stranded DNA along a sequence of about 11 bps, from -9 to +2. The s factor splits off as transcription begins.

It is the specific s factors within a cell that determine which genes will be transcribed. Thus individual cell types are characterized by their s factors.

Chain elongation proceeds in the 5'--> 3' direction, and the "transcription bubble" (the length of "melted" DNA) travels with the RNA polymerase. As a consequence, the unmelted DNA is overwound in front of the bubble and underwound behind the bubble. Topoisomerases then act to relax the positive and negative supercoils. The mRNA that is produced is hybridized for a short length to the DNA at the downstream position, and exists separate from the DNA as a "tail", the point of attachment being at the downstream end. The RNA polymerase does not fall off of the DNA as it is processing because of its relatively tight, but nonspecific, binding on both sides of the transcription bubble, stabilized by its "thumb" wrapping around the DNA. About 20 to 50 nucleotides are transcribed per second at 37 C and one nucleotide is incorrectly transcribed in about every 10 4 . As genes are repeatedly transcribed, this error rate is not too deleterious, especially when coupled with the fact that there are multiple codons ("synonyms") for each amino acid subsequently translated and that single amino acid substitution errors in a protein usually do not hinder its function.

Spontaneous termination of gene transcription is signaled by "termination sequences".In E-coli, the final signal to stop transcription is a series of 4 - 10 A-T base pairings with the A s on the template strand. Pro každého A in this region, the mRNA transcript will have a U . Just upstream from this sequence is a region rich in G a C bases followed by a spacer of nucleotides and another region rich in G a C . The two G , C rich regions are such that one region can be superimposed upon the other by a symmetry operation of 180 o . This relationship of base pairs around a center of rotational symmetry is called a "palindromic sequence". The resulting string of nucleotides at the 3' end of the mRNA is such that a hairpin loop can form, the G s base-pairing with the C s and vice versa, and the As with the Us. The most terminal part of the 3' end is a series of U s followed by a hydroxyl group. As the loop is forming, the RNA polymerase pauses at the termination site. The terminal oligo- U tail, which is only weakly bound to the DNA template strand, is displaced by the non-template DNA strand. Now the mRNA strand is free of the DNA template. However, there are numerous other factors that influence the overall process of termination.

Nonspontaneous termination of transcription requires a "rho factor" protein, which also functions to improve the spontaneous termination efficiency. The rho factor recognizes a sequence on the growing mRNA chain, upstream from the termination site, after which it attaches and moves along the chain in the 5'-3' direction until it reaches the RNA polymerase that is paused at the termination site. The transcript is released from its template strand by the unwinding of RNA-DNA duplex by the rho factor.

Transcription in Eukarytes:

While very similar to that in prokaryotes, the "machinery" and control sequences of transcription in eukaryotes is much more complex, and there are numerous RNA polymerases.

Ribosomal RNA (rRNA) constitutes about 95% of all RNA and about 67% of the RNA in ribosomes. The remainder of RNA includes transfer RNA (tRNA), messenger RNA (mRNA) and other types present in smaller amounts, like "small nuclear" RNAs (snRNAs) involved in mRNA splicing and "guide" RNAs that are involved in editing of RNA. These latter two processes occur in the post-translation stage of the life cycle of eukaryotic mRNA. All RNAs are coded for by DNA, and the different types of RNA polymerase in eukaryotes reflect this and the fact that, in eukaryotes, translation of mRNA into DNA occurs outside of the nucleus.

Precursors of most rRNA are synthesized in nucleoli with the enzyme RNA polymerase I. Precursors of mRNA are synthesized in the nucleoplasm by RNA polymerase II while RNA polymerase III, also in the nucleoplasm, synthesizes precursors of 5S RNA, tRNAs and other RNAs found both in the nucleus and cytoplasm. Mitochondria have their own RNA polymerases, and these are analogous to chloroplast RNAs found in plants. We will focus on RNA polymerase II as it is the one involved in transcription in eukaryotes.

You can look at the structure of yeast RNA polymerase II (see PDB below) as we discuss its structure as a prototype. These are large, multisubunit enzymes, with some of the subunits being homologs of the a,b, and b ' subunits in the prokaryotic RNA polymerase. The overall shape of the enzyme is similar to that of the prokaryotic RNA polymerase ( and DNA polymerase), namely that of a hand with a "thumb" motif that flanks a channel big enough to contain a piece of B-DNA (about 25 A wide).

We did not yet consider the chemistry of the elongation of the mRNA chain, but we will do so here. The chains are elongated in the direction 5' --> 3' by nucleophilic attack of the 3' OH group of the growing chain by the a- phosphate of the incoming NTP.

As in prokaryotes, eukaryotic transcription begins by recognition of promoters. There are many copies of the rRNA genes that direct rRNA synthesis, all with almost identical sequences. This redundancy assures an adequate supply of rRNA which, as we mentioned previously, comprises about 95% of cellular RNA. The promoters for these almost identical genes are, therefore, identical, so RNA polymerase I must only recognize one promoter sequence. However, the RNA polymerase I is species-specific (RNA poly II and III are not species specific).

For promotion of mammalian rRNA,, there is a "core promoter element" that spans the region -31 to +6 (note that this overlaps a region of the gene that is transcribed) and an "upstream promoter element" that spans -187 to -107.

For transcription of genes by RNA polymerase III, the promoter is sometimes located in a segment within the transcribed part of the gene, between +40 and +80, but can also be partially upsteam or entirely upstream fro the start site.

RNA Polymerase II Promoters and Control Sequences

Promoter sequences for RNA polymerase II are diverse. We can divide these into two classes: those that are found in genes that produce proteins at about the same rate in all cells ( "constitutive enzymes") and those for genes whose production rates vary greatly from one cell type to another and depend upon the needs of a differentiated cell at a given time ("inducible enzymes").

Constitutive Gene Promoter Elements:

The GC Box : This is a region containing one or more copies of the sequence GGGCGG (or its complement) in a location upstream from the start site, and it is analogous to the prokaryotic promoter elements.

Other promoter elements are also found in the -50 to - 110 region upstream from the GC box.

Selectively Expressed Gene Promoter Elements:

The TATA Box : A region located at about -25 to -30 that is rich in the nucleotides "A" and "T" and that resembles the Pribnow Box (TATAAT). Genes can still be transcribed in the presence of a defective TATA box and it is thought that the TATA box is involved in choosing the transcription start site

The CCAAT Box : This is a sequence that is often found upstream to the TATA box, located at about -70 to -90. These bind RNA polymerase II as well as other proteins needed for initiation of transcription.

Control Sequences for Structural Genes:

Other regions of the chromosome, some far-removed from the start site, can affect the binding of RNA polymerase II to promoter elements. These gene elements are called "enhancers" and "silencers". Proteins called "activators" and "repressors" can bind to the enhancers and silencers , thus affecting polymerase binding to the promoters. Furthermore, the same protein can function as both an activator or a repressor, depending upon the specific interaction ("dual-acting" transcription factors).

Recruitment of RNA Polymerase II to the Promoter:

Eukaryotes do not have a simple protein that corresponds to the s factor in prokaryotes. Rather, there is a set of proteins that together perform the same function as the s factor, and these are the "general transcription factors" ("GTFs"). We have already looked at structures of transcription factors when we discussed DNA-protein interaction in a previous lecture. Otherwise, the general mechanisms of transcription initiation are similar.

There are 6 GTFs that are required for a low and invariant basal rate of transcription, and this rate can be increased by the participation of other protein factors. These GTFs form a "preinitiation complex" that begins when the "TATA binding protein" ("TBP") binds to the TATA box (if there is one) of a promoter. The specific sequence at which it binds identifies the transcription start site. As a result of this binding, the DNA is distorted by kinks at both ends of the TATA box. Other GTFs bind successively, followed by the binding of RNA polymerase. Finally, the remaining GTFs bind.

After TBP (which is a component of TFIID) binds, the sequence of binding is as follows:

TFIIH has two important enzyme activities. The first is an ATP-dependent helicase activity that assists the formation of an open complex and the second is a kinase activity that results in the phosphorylation of the largest subunit of RNA polymerase II at its C-terminal end. Now the transcription elongation process can begin, with the various GTFs (except TFIIF) dissociating from the complex as elongation occurs. TFIID remains bound to the promoter so that repeated transcription can occur as GTFs reassemble to form the preinitiation complex.

This discussion has focused on RNA polymerase II different transcription factors are needed for RNA polymerases I and III. However, all three require TBP.

Cells control the transcription of every gene individually. A unique combination of silencers and enhancers for each gene modulates the transcription rate. How do activator and repressor proteins that are bound far from the promoter influence that transcription of genes?

"Specificity protein 1" (Sp1) was the first člověk transcription factor that was found that could recognize a specific GC regulatory enhancer sequence. This protein has two interesting modules:

(1) A module of 3 zinc fingers at one end

(2) A module at the opposite end with 2 discrete segments rich in Gln.

Mutants that do not have the glutamine-rich end can bind to DNA but transcription is not stimulated. Therefore, the glutamine-rich end must need to bind to something else for transcription to occur, and these are the "coactivators". They are also called "TBP-Assicuated Factors" or "TAFs" and there are at least eight of them that are important to transcriptional activation. These are not basal factors (GTFs) and they do not bind to specific DNA sequences. Rather, they bind avidly to TBP and provide for multiple "docking sites" to the activators. In this sense, they are "adaptor molecules". A "toolkit" of such adaptor molecules provides for tremendous diversity of options to modulate transcription of a gene. So, expanding on our previous comparison of the preinitiation complex of GTFs to the prokaryotic s factor, a better comparison would be between the s factor and the entire complex of activator-coactivator-basal preinitiation complex. As to how this arrangement modulates of influences the rate of transcription, it is probably mediated primarily by distortion of DNA that facilitates the movement of RNA polymerase II along the coding region.

Latchman (TRENDS in Biochemical Sciences Vol. 26 No.4 April 2001) has pointed out the importance of the DNA binding site itself as playing a key role in transcriptional modulation. The same transcription factor can assume different conformations as a result if binding to different sites. The conformational changes are induced by the DNA-protein interaction, thereby increasing the flexibility of the spectrum of control of transcription, since one protein can act like an entire collection of proteins, each having its own effect (activation, inhibition or no effect).

To carry this one step further, one can imagine that a similar phenomenon can occur when coactivators bind to activators. Perhaps different conformational changes are similarly induced in the bound protein depending upon type of protein-protein interaction. Such conformational changes can then result in different ability to modulate transcription.

The activation domains of transcription factors are often glutamine-rich, but others are proline-rich or acidic. In some cases, hydrophobic residues are interspersed among the acidic or glutamine residues and are important for activation. Tjian (Cell, Vol. 77, 5-8, April 8, 1994) suggests that hydrophobic forces drive cohesion of activation domains with their targets and that specificity is achieved by the periodicity of the cohesive elements.

Genes are transcribed at measurable rates only if the correct activators are present and are able to overcome the effects of repressors.


Podívejte se na video: Genetika NEZkreslená věda III (Listopad 2021).