Informace

Existuje přirozený výskyt indukované pluripotence / exprese faktorů Yamanaka a jaké je její evoluční vysvětlení?


Existují přirozené biologické procesy, ve kterých úplné (úplné přeprogramování do pluripotentního stavu) nebo částečné (částečné přeprogramování, zastavené před bodem bez návratu, zachovávající funkční rozlišovací schopnost buňky) indukovalo pluripotencii (https: //en.wikipedia .org/wiki/Induced_pluripotent_stem_cell) a vyjádření faktorů Yamanaka? Jaké je evoluční vysvětlení takových omlazovacích faktorů? Chtěl bych vidět přirozené vysvětlení, jinak to vyžaduje myšlenku, že vesmír je vytvořen s cílem člověka (antropocentrická hypotéza) a je to pro mě docela neklidné.

Myslím, že přirozené reprodukční procesy mohou zahrnovat nějaký druh omlazení/indukované pluripotence a určovaly existenci faktorů Yamanaka.


Co je pluripotentní kmenová buňka?

Pluripotentní kmenová buňka je buňka, která se může diferencovat do jakékoli z hlavních kategorií tkání. Každé zvíře existuje jako sbírka pluripotentních kmenových buněk v rané fázi vývoje: pokud hledáte evoluční účel, zde byste měli začít a účel je zcela zřejmý: začínáte jako jedno oplodněné vajíčko a skončíte jako komplexní sbírka tkání, takže v určitém okamžiku se jedna buňka musí stát sbírkou tkání a existuje mezistupeň, kterým je pluripotentní buňka.

Nic z toho nemá nic společného indukovaný pluripotence, nicméně.

Co dělá buňku pluripotentní?

Odpověď na tuto otázku není ve skutečnosti u kmenových buněk tak jedinečná: všechny typy buněk se liší od ostatních na základě jejich vyjádření transkripční faktory. Transkripční faktory určují, jaké proteiny se produkují (včetně dalších transkripčních faktorů), což zase určuje, jak buňka funguje a jakou roli hraje.

Pluripotentní kmenové buňky exprimují transkripční faktory pluripotentních kmenových buněk. Yamanaka začal s embryonálními kmenovými buňkami a hledal transkripční faktory, které byly pro tyto buňky speciální.

Co to znamená vyrobit pluripotentní kmenovou buňku?

Vzhledem k tomu, že identita buňky je založena na transkripčních faktorech, které vyjadřuje, způsob, jak přimět jeden typ buňky, aby působil jako jiný typ buňky, je změnit tyto transkripční faktory. Buňka je docela komplikované prostředí: existuje spousta různých transkripčních faktorů a spousta dalších typů proteinů, takže je možné, že by nebylo možné buňku přeprogramovat tímto způsobem.

Yamanaka a kolegové se však pokusili uměle přimět dospělou buňku, aby produkovala ty transkripční faktory pozorované v embryonálních kmenových buňkách. Skutečně zjistili, že pokud použili správnou kombinaci transkripčních faktorů ve správném prostředí, buňky se začaly chovat jako embryonální buňky a mohly by dále tyto buňky odlišit do různých typů tkání. Tyto transkripční faktory jsou takzvané Yamanaka faktory.

souhrn

Indukovaná pluripotentní kmenová buňka je buňka, která byla transformována za vzniku transkripčních faktorů, které se nacházejí v embryonálních buňkách. Transkripční faktory jsou to, co odlišuje různé typy buněk od sebe navzájem tím, že řídí vše ostatní, co buňka produkuje. Celá tato mašinerie je ve vývoji všudypřítomná, jediný zásah, který lidé dělají, je vytvořit v buňce geny, které by normálně exprimovaly pouze v případě, že by to byla embryonální buňka.

Všechny tyto informace jsou již obsaženy v článku Wikipedie, který jste propojili.


Takahashi K, Yamanaka S (2006). „Indukce pluripotentních kmenových buněk z kultur myších embryonálních a dospělých fibroblastů definovanými faktory“. Buňka. 126 (4): 663-76.

Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007). „Indukce pluripotentních kmenových buněk z dospělých lidských fibroblastů definovanými faktory“. Buňka. 131 (5): 861-72.

Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA (2007). „Indukované pluripotentní linie kmenových buněk odvozené z lidských somatických buněk“. Věda. 318 (5858): 1917-20.


Regenerace složitých tkání, jako jsou končetiny, je známá u mnoha zvířat. Salamander byl použit jako model pro regeneraci končetin. Během regenerace buňky v místě amputace oddělit tvořit to, co je známé jako blastém, který se zase diferencuje a vytváří různé druhy buněk.

Christen a kol. (2010) zjistili, že de-diferenciace u zebrafish zahrnuje upregulaci některých faktorů Yamanaka.

Zjistili jsme, že některé z faktorů spojených s pluripotencí (oct4/pou5f1, sox2, c-myc, klf4, tert, sall4, zic3, dppa2/4 a fut1, homolog ssea1) byly vyjádřeny před a během regenerace a že alespoň dva z těchto faktorů (oct4, sox2) byly také vyžadovány pro normální regeneraci žeber u zebrafish. Tyto faktory však nebyly během regenerace upregulovány, jak by se dalo očekávat, pokud buňky blastema získaly pluripotenci

Existují důkazy pro expresi homologů Sox-2, Klf4 a c-Myc v regenerujících tkáních mloků také (Maki et al., 2009)

Když to řeknu, zopakuji, co řekl Bryan Krause ve své odpovědi: tyto faktory jsou zásadní pro obnovu a udržování embryonálních kmenových buněk. Některé z těchto faktorů (zejména Sox2) jsou také exprimovány v neembryonálních multipotentních buňkách, jako jsou neurální kmenové buňky (Seo et al., 2011; Sarkar a Hochedlinger, 2013; Zhang a Cui, 2014).

c-Myc je protoonkogen a normálně se podílí na buněčné proliferaci ve všech aktivně se dělících buňkách.


Expresní analýza faktorů pluripotence v nediferencované vepřové vnitřní buněčné hmotě a epiblastu během kultivace in vitro

Omezené chápání důležitosti známých faktorů pluripotence v embryonálních kmenových buňkách prasat (ESC) brání vzniku a validaci prasečích linií ESC. Tato studie hodnotila expresi známých myších ESC a humánních ESC (hESC) pluripotentních markerů v in vivo vnitřní buněčné hmotě (ICM) a in vitro ‐ kultivovaných nediferencovaných vepřových epiblastových buňkách izolovaných z 8 ‐ denních prasečích blastocyst, primárních kultur epiblastu a#8208 odvozeného neuroprogenitoru buňky a endodermové buňky. Byl hodnocen expresní profil běžných pluripotentních markerů (transkriptový faktor domény POU 5, transkriptový faktor domény 1, SRY ‐box obsahující gen 2 a homeobox Nanog), druhově ‐ specifických markerů, faktorů spojených s ESC ‐ a diferenciačních markerů. MRNA nekultivovaných ICM, kultivovaných epiblastových buněk, epiblastů odvozených neuroprogenitorových buněk a buněk endodermu byla amplifikována před expresní analýzou kandidátských genů skutečnou RT RT#8208PCR. ESC faktory, jejichž exprese nejlépe korelovala s nediferencovaným stavem epiblastů, byly identifikovány srovnávací expresní analýzou mRNA mezi liniemi prasečích epiblastů a derivovanými somatickými buněčnými liniemi, fetálními fibroblasty a dospělými tkáněmi. Nanog homeobox napříč tkáňovými typy vykazoval všudypřítomnou expresi, zatímco transkriptový faktor 1 domény POU 5, teratokarcinom & odvozený růstový faktor 1 a RNA exonukleázový homolog 1 transkriptová exprese byla omezena primárně na nediferencované epiblasty. Naše výsledky naznačují, že exprese markerů pluripotence v nediferencovaných buňkách epiblastu prasete se více podobá expresi pozorované v hESC. Změny exprese faktorů spojených s ESC ‐ v epiblastových buňkách byly také pozorovány během kultivace in vitro. Naše data demonstrují potenciální využití některých faktorů pluripotence jako markerů kmenových buněk prasečích epiblastů a naznačují, že prostředí in vitro může ovlivnit vývojový stav kultivovaného epiblastu. Mol. Reprod. Dev. 75: 450 & ndash463, 2008. & copy 2007 Wiley ‐Liss, Inc.

Časopis

Molekulární reprodukce a vývoj & ndash Wiley

Zveřejněno: 1. března 2008

Klíčová slova: epiblast vnitřní buněčná hmota pluripotence embryonální kmenové buňky trophektoderm


Úvod

Exomy a genomy rakoviny jsou sekvenovány prostřednictvím společného mezinárodního úsilí multicentrických konsorcií, což vede k vytvoření rozsáhlých datových sad mutací spojených s rakovinou. Které z těchto mutací ve skutečnosti vedou k rakovině a jak ovlivňují funkci mutovaného proteinu, je však do značné míry nejasné. Zejména odlišit řidiče rakoviny od mutací cestujících zůstává velkou výzvou. Mutace řidičů přinášejí výhody růstu s kauzálními rolemi v progresi onemocnění, zatímco cestující jsou náhodní a nemají vliv na způsobilost rakovinotvorných buněk [1]. Zkoumání funkčních důsledků variant nejistého významu je proto hlavním cílem lékařské genetiky. Aby se systematicky vyšetřil dopad missense mutací v genech způsobujících rakovinu, byly u supresorů nádorů, jako jsou p53 [2], PTEN [3] a BRCA1 [4], implementovány testy s vysokou propustností, a to hodnocením přežití buněk, hojnosti bílkovin a enzymatické aktivity. nebo vazba kofaktoru.

Generování indukovaných pluripotentních kmenových buněk (iPSC) s koktejlem boxu 2 souvisejícího se SRY (SOX2), proteinu vázajícího oktamer 4 (OCT4), faktoru podobnému Krüppelu (KLF4) a buněčného MYC (c-Myc) prokázal, že násilná exprese transkripčních faktorů (TF) vede k dramatickému přeprogramování buněčných stavů [5, 6]. Následně bylo zjištěno, že přeprogramování somatických buněk do pluripotentního stavu a onkogenní transformace mají mnoho koncepčních paralel [7]. Pluripotenční přeprogramování a tumorigeneze kriticky závisí na tvorbě samoobnovujících se buněčných populací. Oba procesy zahrnují hluboké epigenetické změny, metabolické přepínání, přechody mezi mezenchymálními a epiteliálními charakteristikami a také proliferativní a morfologické změny. Kromě toho bylo hlášeno, že všechny čtyři klasické faktory přeprogramování pluripotence, SOX2 [8-10], OCT4 [11], KLF4 [12] a c-MYC [13], jsou spojeny nebo dokonce řídí onkogenezi. Tyto úvahy nás motivovaly k otázce, zda přeprogramování somatických buněk na pluripotencii poskytuje vhodný experimentální systém pro studium funkčního dopadu rakovinotvorných mutací missense. SOX17 normálně nepodporuje indukci pluripotence, pokud je nahrazen SOX2 [14]. Přesto jsme do naší studie zahrnuli SOX17 pro jeho prokázanou konverzi na induktor pluripotence s jednoduchou mutací missense [15, 16] a jeho klasifikaci jako mutovaný gen řidiče rakoviny u rakoviny endometria [17-19].

Abychom prozkoumali, zda mutace missense související s rakovinou ovlivňují přeprogramování pluripotence, vybrali jsme mapování mutací na OCT4, SOX2 a SOX17 a testovali jsme je při konverzi myších embryonálních fibroblastů (MEF) na iPSC. OCT4 je klíčovým regulátorem specifikace pluripotence, totipotency a zárodečné linie [20]. Protein OCT4 patří do rodiny Pit-OCT-Unc (POU) s bipartitní doménou vázající DNA zprostředkující rozpoznávání oktamerního elementu sekvence DNA podobného ATGCAAAT [21] a několika variant palindromických sekvencí, kde se váže jako homodimer ( přezkoumáno v [22]). SOX2 a SOX17 patří do rodiny boxových faktorů skupiny high-mobility group (HMG) souvisejících s faktorem SRY určujícím varlata (odtud jejich název SRY-related box: SOX), které rozpoznávají sekvence DNA podobné CATTGTC [23]. Boxové domény POU a HMG zprostředkovávají nejen sekvenčně specifickou vazbu DNA, ale také tvorbu heterodimerů závislých na DNA (přehled v [24]). Například během přeprogramování pluripotence a udržování pluripotentního stavu SOX2 a OCT4 heterodimerizují [25-29]. Jejich přidružení je usnadněno vyhrazeným proteinovým kontaktním rozhraním na šroubovici 3 HMG boxu, specifickým pro POU (POUS) doména OCT4 spolu s kompozitním „kanonickým“ prvkem DNA podobným CATTGTCATGCAAT [30]. Během specifikace extraembryonického primitivního endodermu OCT4 přepíná partnery a nyní se spojuje s SOX17 na alternativním „komprimovaném“ CATTGTATGCAAAT elementu DNA [15, 31]. V poslední době byly také navrženy heterodimery SOX17/OCT4 ke specifikaci lidské zárodečné linie [32, 33]. Výměny domén a mutační analýzy odhalily, že schopnost SOX2 a OCT4 indukovat pluripotenci závisí především na vlastnostech jejich domén HMG a POU vázajících DNA, zatímco oblasti mimo tyto domény jsou pro své specifické funkce méně kritické [34–37]. Bylo zjištěno, že mutace v doménách HMG a POU narušují schopnost SOX2 a OCT4 generovat iPSC [15, 35, 36, 38-40]. V experimentech přeprogramování pluripotence nemohou nervový faktor OCT6 a endodermální faktor SOX17 nahradit OCT4 a SOX2 [14]. Oba proteiny by však mohly být racionálně mutovány tak, aby nahradily OCT4 a SOX2 v pluripotency přeprogramování s mutacemi v doménách POU a HMG [15, 34, 35]. V SOX17 jedna aminokyselinová substituce převádí tento protein na vysoce účinný induktor pluripotence, který překonává SOX2 v přeprogramování myší i lidí [15, 34].

Zde jsme vytěžili komplexní databázi katalogu somatických mutací v rakovině (COSMIC) (http://cancer.sanger.ac.uk) [41] pro mapování mutací missense na členy rodiny SOX a POU a vybrané varianty s potenciálem ovlivnit kapacita OCT4, SOX2 a SOX17 generovat iPSC. Identifikovali jsme dvě mutace spojené s rakovinou, které zvyšují aktivitu přeprogramování OCT4 (OCT-K128N, OCT4-C198R) a několik mutací SOX2, které zeslabují nebo mírně zvyšují její aktivitu přeprogramování. Ukazujeme, že mutace SOX17-V118M pozorovaná ve čtyřech různých vzorcích nádorů (karcinom prostaty, prsu a střeva) převádí SOX17 na induktor pluripotence, vede ke zvýšení stability proteinu a podporuje tumorigenní transformaci. Navrhujeme buněčné přeprogramování jako vhodný test ke studiu vztahu sekvence - struktura - funkce rakovinných mutací. Předpovídáme, že místa mutace hotspotů představují cennou příručku pro návrh knihoven pro škálovatelnou směrovanou evoluci faktorů přeprogramování výběrem a sekvenováním buněk [16, 42].


MATERIÁLY A METODY

Chov myší, inscenace, kultura a mikromanipulace embryí

Myši byly udržovány v cyklu 12 hodin světlo/12 hodin tma. U časovaných páření bylo poledne v den vaginální zátky označeno E0,5. Pokud není uvedeno jinak, kmeny divokého typu byly MF1 nebo 129/Ola. Embrya ve stadiu gastrulace byla uspořádána podle popisu (Downs a Davies, 1993): ES, časný pruh MS, střední pruh LS, pozdní pruh OB, žádný alantoický pupen EB, časný alantoický pupen LB, pozdní alantoický pupen EHF, časný záhlavní LHF, pozdní pokrývka hlavy.

Embrya byla kultivována ve statických 4jamkových miskách v inkubátoru při 5% CO2 ve vzduchu v 50% krysím séru, jak je popsáno (Copp, 1990). Injekce blastocysty a přenos embryí byly provedeny pomocí standardních postupů.

Všudypřítomně indukované exprese Oct4 bylo dosaženo křížením samic divokého typu s homozygotními samci nesoucími doxycyklinem indukovatelný reverzní transaktivátor tetování (rtTA) cílený na Rosa26 a transgen Oct4 reagující na doxycyklin (TgOct4) zaměřeno na Col1a1 [B6129-Gt (ROSA) 26Sor tm1 (rtTA*M2) Jae Col1a1 tm2 (tetO-Pou5f1) Jae/J (Hochedlinger et al., 2005)].

Disekce tkání pro roubování, kultivaci explantátu a expresní analýzu

Subregiony embrya divokého typu (C57BL/6, 129 a CBA) byly rozřezány v M2 (Sigma), jak je popsáno (Cambray a Wilson, 2007). Pro disekci distálních/předních (Nanog: GFP negativní) a proximálních/zadních (Nanog: GFP pozitivních) oblastí embrya E7.5 byla embrya nejprve uspořádána vzhledem k vývojovému stadiu a zobrazena za účelem posouzení GFP pozitivních a negativních oblastí. Byl proveden příčný řez k oddělení nejproximálnějšího epiblastu, obsahujícího prvotní zárodečné buňky, spolu s extra-embryonální oblastí, od distálního epiblastu. Byl proveden druhý řez k oddělení distálních/předních a zadních/proximálních oblastí. Nakonec byla embrya prohlédnuta fluorescenční optikou, aby se zkontrolovala přesnost mikrodisekce, všechny zbývající buňky pozitivní na Nanog-GFP byly oříznuty z distálních předních oblastí. K disekci prospektivního předního mozku (oblast 1) a přilehlé oblasti (oblast 2) byly odstraněny extra-embryonální membrány a embryo bylo položeno ploché dorsoventrálně, v případě potřeby pomocí příčného řezu poblíž uzlu (viz obr. 5). Přední mozek a přilehlá oblast byly poté odděleny skleněnými jehlami.

Testy teratokarcinomu

Transplantáty ledvinových kapslí byly provedeny tak, jak je popsáno (Tam, 1990), kromě toho, že přenos do NOD/SCID myší byl proveden ve skříni s laminárním tokem. Po transplantaci E8.5 TgOct4/+rtTA/+ předním mozkům byla polovina hostitelských zvířat podávána 1 mg/ml doxycyklinu (Sigma) prostřednictvím pitné vody po dobu 4 týdnů. Nádory byly získány po 4 až 6 týdnech a fixovány ve 4% paraformaldehydu (PFA) po dobu 1 až 7 dnů v závislosti na velikosti nádoru. Tkáň byla zpracována a obarvena, jak je popsáno (Bancroft a Gamble). Tkáně reprezentující různé zárodečné vrstvy použité pro hodnocení všech nádorů jsou uvedeny v doplňkovém materiálu obr. S2.

Explantace a kultura EpiSC

K odvození linií EpiSC E7.5-E8.0 (OB-2s) byla embrya rozřezána, disociována (bez odstranění endodermu nebo mezodermu) a vysvětlena do média EpiSC (Tesar et al., 2007) doplněného 20 ng/ml aktivinu -A (PeproTech) a 10 ng/ml bFGF (R & amp D) a naneseny na ozářené fibroblasty myších embryí (MEF). Po 2 až 3 dnech byly primární explantáty pasážovány inkubací s 1 x akutázou (Sigma, katalogové číslo A 6964) (5 minut) a poté rozetřeny do 10 až 100 buněčných shluků, neutralizovány médiem EpiSC a nahrazeny. Následné pasáže byly prováděny každých 5-6 dní. Kultury byly označeny jako buněčné linie, když dosáhly pasáže 3, vykazující morfologii EpiSC a silnou proliferaci.

TgOct4-byly odvozeny nadměrně exprimující explantáty a EpiSC TgOct4/TgOct4rtTA/rtTA homozygotní samec křížený se samicemi 129/Ola divokého typu nebo samicemi Nanog: GFP [129-Nanog tm1 (GFP-IRES-Puro)], odvozenými z ES buněk cílených na TNG (Chambers et al., 2007). Médium bylo zpočátku doplněno doxycyklinem o koncentraci 1 mg/ml a po třech pasážích se snížilo na 0,5 mg/ml. Nanog -/ - EpiSC byly odvozeny in vitro z ES buněk, jak je popsáno (Guo et al., 2009), a pasážovány v accutase, jak je uvedeno výše. Oct4GiP EpiSC byly odvozeny z ES buněk nesoucích transgen eGFPiresPuroR-polyA poháněný promotorem Oct4 (Ying et al., 2002). Když byly přidány, byly použity chemické inhibitory v těchto koncentracích: PD0325901 (Stemgent), 1 uM SB 431542 (Sigma), 10 uM JAK inhibitor I (Calbiochem 420099), 0,6 mM.

Sekundární EpiSC odvozené z teratokarcinomu

Nádory byly izolovány a rozřezány zhruba před disociací v 0,5% trypsinu/2,5% pankreatinu v PBS (37 ° C, 15 minut). Po trituraci byly buňky naneseny na ozářené MEF v médiu EpiSC, pasážovány další den a poté každé 2-3 dny.

RNA analýza

Celková RNA (30 ng-1 μg) izolovaná pomocí RNeasy microkit nebo minikit (Qiagen) byla použita pro syntézu cDNA pomocí SuperScript III (Invitrogen). Kvantitativní PCR byla provedena pomocí Light Cycler 480 SYBR Green I Master Mix (Roche). Sekvence primerů PCR jsou k dispozici na vyžádání. Hodnoty pro každý gen byly normalizovány na expresi proteinu vázajícího TATA-box (TBP) a vyjádřeny jako průměr ± s.e.m. alespoň tří replikátů, vztaženo k hladinám ES buněk.

Imunohistochemie a imunocytochemie

Celá embrya nebo kultivované buňky byly fixovány použitím 4% PFA v PBS po dobu 2 hodin (embrya) nebo 10 minut (buňky) při 4 ° C s následnou permeabilizací v 0,5% Triton X100 (Sigma) v PBS po dobu 15 minut. Vzorky byly inkubovány v 1 M glycinu v PBS/0,1% TritonX100 (PBST) po dobu 20 minut a blokovány přes noc při 4 ° C za použití 3% séra (Sigma), 1% BSA (Sigma) v PBST. Primární protilátky byly zředěny v blokovacím pufru na níže uvedené pracovní koncentrace a aplikovány po dobu 1-2 hodin při pokojové teplotě (buňky) nebo 48 hodin při 4 ° C (embrya). Po třech (buňkách) nebo čtyřech až šesti (embryích) promytích PBST (15 minut při pokojové teplotě) byly sekundární protilátky konjugované s Alexa (molekulární sondy 2 μg/ml v blokovacím pufru) aplikovány po dobu 1 hodiny (buňky) nebo 3 hodiny ( embrya) ve tmě při pokojové teplotě. Buňky/embrya se poté promyly alespoň třikrát v PBST a následovala inkubace v 4 ', 6-diamidino-2-fenylindolu (DAPI) k obarvení jader. Koncentrace primárních protilátek byly: Nanog, 1,4 μg/ml (Chambers, 2004) (embrya) nebo 2,5 μg/ml (ab14959, Abcam) (buňky) Oct4, 1 μg/ml (Santa Cruz, N-19) (embrya) nebo 1 μg/ml (Santa Cruz, C-10) (buňky) Sox2, 1 μg/ml (Santa Cruz, Y-17) (buňky).

Hybridizace in situ

Celá situace in situ byla provedena, jak je popsáno (Wilkinson et al., 1990), léčba proteinázou K byla empiricky upravena mezi 8-16 minutami podle velikosti embrya a stadia. Použité riboprobes byly: 4. října (Scholer et al., 1990) a Nanog (Chambers et al., 2003). Embrya byla rozřezána na parafínový vosk (7 μm).

Zobrazování

Obrázky byly zachyceny pomocí softwaru Volocity (Improvision) na pitevním mikroskopu Zeiss Stemi SV11 (pro celá embrya), Olympus IX51 (pro kultivované buňky) nebo Olympus BX61 (pro řezy). Zpracování obrazu bylo provedeno pomocí softwaru Adobe Photoshop. V případě celých embryí obarvených Oct4 byla fluorescence vizualizována pomocí invertovaného konfokálního mikroskopu Leica DM IRE2 (Leica Microsystems). Sběr a zpracování obrazu bylo provedeno pomocí softwarových balíků Leica Confocal (Leica Microsystems) a Volocity (Improvision).

Analýza obrazu

Abychom kvantifikovali fluorescenční signál na jádro, vytvořili jsme poloautomatické potrubí pro analýzu obrazu. Oblasti zájmu o embrya byly oříznuty a analyzovány souběžně s vnitřní negativní kontrolní oblastí (doplňkový materiál obr. S5). Tyto RGB obrazy byly předem zpracovány [odečtení pozadí v každém kanálu a gama korekce v modrém kanálu (DAPI) pro posílení slabě fluoreskujících jader] pomocí našeho vlastního plug-inu v ImageJ (http://rsbweb.nih.gov/ij/ ). K rozlišení jednotlivých jader byl modrý kanál segmentován pomocí dříve publikovaného algoritmu (Li et al., 2007) s následujícími parametry a jejich příslušnými hodnotami pro 2D a 3D obrazy: sigma 0,1 (2D) 0,15 (3D), minimální velikost jádra 350 pixelů (2D a 3D) a práh fúze 2 (2D) 1 (3D) viz doplňkový materiál obr. S5). Na výsledném obrázku je každé jádro označeno jedinečným identifikátorem ve stupních šedi. Pomocí aplikace Java, kterou jsme vyvinuli v rámci zatmění (www.eclipse.org), byly vypočteny průměrné intenzity pixelů v červených a zelených kanálech předzpracovaného obrazu RGB v superponovaném objemu každého jádra. Grafy představující průměrnou intenzitu červené a zelené byly generovány pomocí knihovny Jfreechart (http://www.jfree.org/jfreechart/). Aplikace vyvinuté pro tuto analýzu lze stáhnout na adrese http://www.crm.ed.ac.uk/research/group/embryonic-stem-cell-differentiation.

Methylační analýza DNA

Sekvenování siřičitanu bylo provedeno za použití soupravy pro modifikaci DNA Imprint (Sigma) společně s primery meNanog-F2-S a meNanog-F2-AS (Imamura et al., 2006). Přibližně 30 klonů bylo sekvenováno. Sekvence charakterizované neúplnou konverzí hydrogensiřičitanu byly vyřazeny.

Izolace regulačních prvků za pomoci formaldehydu (FAIRE)

Byly použity buňky MEF nebo E14Tg2a (1 × 107). Embrya MF1, připravená tak, jak bylo popsáno dříve (Downs a Davies, 1993), byla rozřezána bez extra-embryonální tkáně (včetně alantois obsahujících primordiální zárodečné buňky). Embrya byla spojena [pro E7,5 (LB-EHF), 27-30 embryí pro E8,5 (2-8 somitů), 20-22 embryí] a disociována v 0,5% trypsinu/2,5% pankreatinu/PBS. Pro explantáty E8,5 bylo 20-22 disociovaných embryí kultivováno v podmínkách EpiSC s nebo bez 1 mg/ml doxycyklinu. Po 24 hodinách se explantáty trypsinizují, převádějí na neželatinizované misky pro tkáňové kultury po dobu 15 minut, aby se vyčerpaly krmítka, a shromáždí se.

Formaldehydem zesítěný, sonikovaný chromatin byl připraven, jak bylo popsáno dříve (Navarro et al., 2010), a 20 μg použitých k přípravě FAIRE a referenčních vzorků. U vzorku FAIRE byly molekuly DNA bez proteinu zesítěného chromatinu přečištěny extrakcí fenol-chloroformem a vysráženy ethanolem, jak bylo popsáno dříve (Giresi et al., 2007). U referenčního vzorku bylo zesíťování obráceno inkubací přes noc při 65 ° C v TE/1% SDS, extrahováno fenol-chloroformem a vysráženo ethanolem. FAIRE a referenční vzorky byly analyzovány paralelně za použití LightCycler 480 (Roche) a LightCycler 480 SYBR Green 1 Master (Roche). Sekvence primerů byly: Nanog, TGGCCTTCAGATAGGCTGAT (sense) a CAAGAAGTCAGAAGGAAGTGAGC (antisense) Sox2, AGGGCTGGGAGAAAGAAGAG (sense) a CCGCGATTGTTGTGATTAGTT (antisense) Oct4 distální enhancer AGAGTGCTGTCTAGGCCTTA (sense) a CCAGAACTCTCAACCTCCCT (antisense) Oct4 proximální enhancer, GGGAAGCAGGGTATCTCCAT (sense) a TCCCCTCACACAAGACTTCC (antisense ).


NOVÁ STUDIE ROZPISUJE VŠECHNY HLAVNÍ TEORIE STÁRNUTÍ-A ZJIŠŤUJE NOVINU: PROGRAMOVANOU ZTRÁTU CELULÁRNÍ DIFERENCIÁLNÍ TEORIE STÁŘENÍ

Sledujte to i nadále, protože tento příspěvek je často aktualizován! Aktualizace se obvykle přidávají na konci.

ZABEZPEČTE SI ZKONTROLOVAT AKTUALIZACI č. 9 a #8211 Je to úžasné! #13 je také docela cool!

Než začneme, dovolte mi povzbudit vaši chuť k tomu, co je obsaženo ve zbytku tohoto článku. Právě byly zveřejněny výsledky nejdůležitější studie o stárnutí EVER, která bude nejdůležitější studií stárnutí všech dob! Steve Horvath ’s:

Univerzální stáří methylace DNA v tkáních savců

Studie přesvědčivě dokazuje, že stárnutí je vybráno evolucí a je naprogramováno. Výsledek, který je v rozporu se všemi hlavními mainstreamovými teoriemi stárnutí, které byly navrhovány od počátku 20. století. Ukázalo se, že August Weisman dostal správnou odpověď v roce 1882, ale se špatným odůvodněním.

Nová studie také odhaluje skutečnou příčinu stárnutí na buněčné úrovni- programovanou ztrátu buněčné diferenciace.

Nedávno byl vydán předtisk článku v časopise, který má být publikován v časopise Nature, který zcela otevírá příčinu stárnutí u savců téměř všech druhů. Článek ukazuje, že toto stárnutí je evolucí vysoce konzervováno a končí debatu o tom, zda je stárnutí způsobeno náhodným poškozením DNA, nebo je naprogramováno. Odpověď?- stárnutí se vyvinulo, je vysoce konzervované a je naprogramováno- o tom není pochyb!

Autorem tohoto článku je Steve Horvath a spoluautorem je dlouhý seznam spolupracovníků. V současné době nese název> Univerzální věk methylace DNA v tkáních savců.

Myslím, že je to nejdůležitější studie týkající se stárnutí a vždy bude. A já studuji stárnutí 35+ let a viděl jsem téměř všechno! Horvath ’s cestuje methylací DNA tolika zvířat je určitě stejně důležitý a pravděpodobně i důležitější než Darwin ’s 5 let na HMS Beagle.

V poslední větě svého abstraktu Horvath statečně uvádí-

“ Souhrnně tato nová pozorování podporují představu, že stárnutí skutečně je evolučně konzervované a spojený s vývojovými procesy napříč všemi druhy savců – pojmem, o kterém se dlouho diskutovalo bez prospěchu tohoto nového a přesvědčivého důkazu. ”

NEJEN TO JE TOTO NEJDŮLEŽITĚJŠÍ STUDIE TÝKAJÍCÍ SE STÁŘENÍ KAŽDÉHO- TAKÉ TO UKAZUJE

VĚDA MAINSTREAM & VERZE TEORIE EVOLUCE#8217S JE ŠPATNÁ!

Všichni tito evoluční profesoři se budou muset vrátit na rýsovací prkno, protože z jejich pohledu na evoluci je nemožné, aby se stárnutí vyvinulo a bylo vybráno, protože je to špatné pro šíření vašich sobeckých genů! Prakticky všichni evoluční biologové věří, že stárnutí vybrané pro evoluci je nemožné!

Ve skutečnosti v jiném článku s odkazem na konci tohoto článku navrhuji, aby sobecká genová teorie evoluce byla většinou správná, ale je to jen polovina příběhu. Chybí polovina evoluční teorie, která teprve bude odhalena. V článku, na který odkazuji na konci, bodnu a uspěji. Dobře, zpět ke stárnutí …

Zde je shrnutí toho, co Horvath et al našli:

Horvath a tento tým se podívali na DNA velkého počtu savců a určili, jaké geny zaznamenaly ve starším věku zásadní změny methylace DNA (jak se zvyšují, tak i snižují). Zvýšená methylace na začátku genu by ji v podstatě vypnula, odstranění methylace od začátku genu by umožnilo expresi tohoto genu ve vyšším věku

Podívali se na změny methylace DNA s věkem u 59 různých typů tkání od 128 druhů savců, aby zjistili, co mají všichni společného.

Našli vysoce konzervovaný program stárnutí poháněný změnami methylace DNA, který z větší části vypnul geny, které vytvářely transkripční faktory přidáním methylových skupin do promotorové oblasti genů. Našli 36 genů, které byly ovlivněny /ukončeny methylací DNA, a téměř všechny z nich byly transkripčními faktory, které se podílejí na diferenciaci buněk během vývoje, které mají domény homeoboxu. Našli jen velmi málo genů, u kterých došlo ke ztrátě methylace, což pro mě bylo překvapením na základě mých předpovědí v mé práci z roku 1998. Čekal jsem, že to bude naopak, protože celý genom během stárnutí ztrácí hodně methylace. Tyto případy hypermethylace tedy musí být velmi zvláštní, aby podpořily celkový trend globální demetylace DNA s věkem, zjevně většina methylace DNA není zapojena do přímé kontroly stárnutí.

Celkově našli v DNA 3 617 případů hypermethylovaných cytosinů spojených se stárnutím a pouze 12 hypomethylovaných cytosinů! To mi vyrazilo dech.

Těch 12 hypomethylovaných míst musí být vedle několika velmi zajímavých genů! Analyzovali tyto hypomethylované geny a zjistili, že gen č. 1, který byl nejvíce hypomethylován v játrech, a č. 2 napříč všemi typy tkání byl gen LARP1. Tento gen, který je ve vyšším věku exprimován více, musí dělat něco velmi zlobivého! Podívejme se na funkci genu LARP 1, jak ji popisuje Wikipedie & gt & gt & gt & gt

No a co víš ?? LARP1 má jedinečnou oblast, která se váže na transkripty RNA! Můj odhad je, že toto je protein, který se podílí na zkrácení proteinu Lamin A v normálně stárnoucích buňkách, a pravděpodobně zkracuje protein WRN v normálně stárnoucích buňkách (zkrácený protein WRN se nachází v normálně stárnoucích a stárnoucích buňkách teprve musí být prokázáno pravdivě-ale jednou předpovídám, že se to stane).

(Pokud vás tyto informace LARP1 nyní nudí, můžete je přeskočit, abyste se dostali k dobrým věcem a vrátili se později!)

z Wikipedie, otevřené encyklopedie

La-related protein 1 (LARP1) je 150 kDa protein, který je u lidí kódován LARP1 gen. [5] [6] [7] LARP1 je nový cíl savčího cíle signální dráhy rapamycinového komplexu 1 (mTORC1), obvod často hyperaktivovaný u rakoviny, který reguluje růst a proliferaci buněk primárně prostřednictvím regulace syntézy proteinů. [8]

LARP1 je největší ze 7členné rodiny proteinů LARP (dalšími jsou: LARP1B, LARP3 (aka pravé La nebo SSB), LARP4A, LARP4B, LARP6 a LARP7). [9] Všechny LARP proteiny, včetně lidských LARP, obsahují 2 konzervované oblasti. První konzervovaná oblast sdílí homologii s La proteiny (nazývá se La motiv, viz SSB), zatímco druhá konzervovaná oblast (nazývaná LA-motiv) je omezena na LARP proteiny. LARP1 a 1B také obsahují na svém C-konci konzervovanou oblast “DM15 ”. [10] Tato oblast je jedinečná a bylo prokázáno, že je nutná pro vazbu RNA.Myší larp1 je exprimován v gangliích hřbetních kořenů a míchy, stejně jako ve vyvíjejících se orgánech charakterizovaných epiteliálními a#8211 mesenchymálními interakcemi. [6] Lidský LARP1 je v normálních ne-embryonálních buňkách přítomen v nízkých hladinách ale je vysoce exprimován v epiteliálních rakovinách (jako jsou rakoviny vaječníků, kolorekta, prostaty, nemalobuněčných plic, hepatocelulárních a cervikálních). [11] [12] [13] [14] Některé studie ukázaly, že vysoké hladiny proteinu LARP1 korelují s horší prognózou u pacientů s rakovinou. [15] [16]

LARP1 se váže a reguluje translaci terminálního oligopyrimidinového motivu (TOPmRNA) a mohou přímo interagovat s 5 ′ cap mRNA. [17] [18] Bylo také ukázáno, že interaguje s 3 ′ koncovými a kódujícími oblastmi (CDS) jiných genů. [17] Protein LARP1 kolokalizuje sstresové granule a P-těla, [19] které fungují při skladování a degradaci RNA. Bylo navrženo, že LARP1 funguje v tělech P k oslabení hojnosti konzervovaných mRNA Ras –MAPK. Shluk homologů LARP1 může fungovat tak, aby řídil expresi klíčových vývojových regulátorů. [19]

Několik studií prokázalo, že nedostatek LARP1 selektivně ovlivňuje nábor TOP mRNA do polysomů V některých rakovinných buňkách nedostatek LARP1 snižuje proliferaci a aktivuje apoptotickou buněčnou smrt. [13] Přestože byl v buňkách umlčených LARP1 zaznamenán pokles množství proteinů kódovaných TOP mRNA, někteří vědci se domnívají, že to lze vysvětlit jednoduše sníženým počtem transkriptů TOP mRNA v buňkách s nedostatkem LARP1.

Ukázalo se, že většinu z toho jsem předpověděl už dávno v roce 1998.

V roce 1998 jsem publikoval článek s názvem „Evoluce stárnutí: nový přístup ke starému problému biologie“

v lékařských hypotézách, září 1998.

Tento dokument byl výsledkem téměř 10 let nepřetržitého 7 dní v týdnu, horečného výzkumu v knihovně Northwestern Medical School, kde jsem četl vše, co jsem o stárnutí našel. Na konci 10 let jsem byl jako první paleontolog, který odhalil kompletní kostru dinosaura, ale kosti byly rozházené. Identifikoval jsem téměř všechny relevantní faktory související se stárnutím. Bylo načase dát kosti dohromady a podívat se, jak dinosaurus vypadá. Stejně jako první pokus paleontologů byl můj sestavený dinosaurus (teorie stárnutí) většinou správný, ale některé kosti byly umístěny do špatné polohy.

Z článku vyšlo mnoho dobrých předpovědí, které se ukázaly jako pravdivé, například:

-Stárnutí je způsobeno ztrátou methylace DNA cytosinů (ve skutečnosti je výsledkem zisku nebo ztráty methylace cytosinu (CH3)), známých také jako epigenetika. Další článek potvrzující tuto předpověď vyšel až v roce 2012> gt Stárnutí, omlazení a epigenetické přeprogramování: resetování hodin stárnutí. Cell 2012 Jan 20148 (1-2): 46-57. (napsal nějaký chlap ve Stanfordu- který nezmínil můj papír z roku 1998)

-Alzheimerova choroba a demence by mohly být způsobeny nárůstem luteinizačního hormonu, ke kterému dochází po 50 letech u mužů i žen. Potvrzeno v roce 2005 na NIH> gt> gt důkazy o roli hormonů gonadotropinů ve vývoji Alzheimerovy choroby. Cell Mol Life Sci. Únor 2005 (3): 293-8.

-Bylo zjištěno, že luteinizační hormon a folikuly stimulující hormon hrají ústřední roli ve stárnutí. Potvrzeno & gt & gt Data mining lidských plazmatických proteinů generuje velké množství vysoce prediktivních hodin stárnutí, které odrážejí různé aspekty stárnutí. Říjen 2020 Stárnoucí buňka 19 (1): e13256 (proteiny č. 1 a č. 2, které se nejvíce zvyšují ve stárnoucí buňce, souvisejí s LH (č. 1) a FSH (č. 2).)

-Hierarchie programované kontroly stárnutí byla předpovězena

Hormonální změny & gt & gt Ztráta methylace & gt & gt & gt Exprese genů, které způsobují stárnutí.

Tato studie dokazuje, že je to pravda, ale v menší míře, než jsem očekával. To, co jsem nečekal, byla další hierarchie odhalená touto studií

Změny hormonů & gt & gt & gt & gt Gain of Methylation & gt & gt & gt Potlačení genů vyžadovaných pro buněčnou diferenciaci.

-A ještě jedna maličkost předpovídala v mém článku 98, to stárnutí VYVINUTO a je PROGRAMOVÁNO a je řízen stejnými věcmi, které řídí vývoj.

-První 2 věty v abstraktu mého příspěvku tvrdily, že stárnutí se vyvíjelo a stárnutí a vývoj spolu úzce souvisely. Tato nová studie dokazuje, že je to 100% pravda.

“Evoluce stárnutí: nový přístup ke starému problému biologie ”

Bowles, JT Medical Hypotézy 9. září

"Většina gerontologů věří, že stárnutí se nevyvíjelo, je náhodné a nesouvisí s vývojem."

Opačný úhel pohledu je s největší pravděpodobností správný. “

Problémy s papírem byly způsobeny mým pokusem dát dohromady všechny stárnoucí dílky skládačky bez dostatečného množství informací. Například jsem si představoval, že protein, který je defektní ve Wernerově syndromu (zkrácený), generuje nadměrné volné radikály během procesu odvíjení DNA, který katalyzoval demetylaci cytosinů v DNA. Myslel jsem, že to umožňuje vyjádření genů pro stárnutí a naplnění těla ničivými proteiny. Dostal jsem nekonečné zesměšňování a výsměch od hlavních teoretiků stárnutí, kteří věřili, že evoluce pro-aging genů je nemožná. Nová studie ukazuje, že existují pro-aging geny, jen ne tolik, jak jsem si představoval. Ukazuje se, že velká část programovaného stárnutí je způsobena potlačením genů, které činí transkripční faktory zapojené do udržování buněčné diferenciace během a po vývoji.

Ve skutečnosti se dělo to, že Helikáza WRN se skládá ze 6 identických podjednotek, které se spojí a vytvoří helikázu. Úkolem helikázy je odvíjení a převíjení DNA. Jediná podjednotka má také další práci jako transkripční faktor, který váže a umlčuje některé geny v kmenových buňkách, aby jim umožnily zachovat jejich diferenciaci a zůstat kmenovými buňkami. To se ale nevědělo, když jsem psal referát, tak jsem to odhadl nejlépe.

Viz & gt & gt Model kmenových buněk Wernerova syndromu odhaluje změny heterochromatinu jako hybnou sílu vědy o stárnutí člověka. 2015 5. června 3488 (6239): 1160–1163.

Wernerův syndrom (WS) je předčasné stárnutí způsobené nedostatkem proteinů WRN. Zde uvádíme zprávu o generování modelu lidského WS v lidských embryonálních kmenových buňkách (ESC). Diferenciace WRN-nulových ESC na mezenchymální kmenové buňky (MSC) rekapituluje rysy předčasného buněčného stárnutí, globální ztráty a změn v architektuře heterochromatinu. Ukazujeme, že WRN se spojuje s heterochromatinovými proteiny SUV39H1 a HP1α a nukleárním lamina-heterochromatinovým kotevním proteinem LAP2β.Cílené klepání katalyticky neaktivních SUV39H1 v MSC divokého typu rekapituluje zrychlenou buněčnou senescenci, připomínající MSC s nedostatkem WRN. Navíc je v MSC detekován pokles WRN a heterochromatinových značek od starších jedinců. Naše pozorování odkrývají roli WRN při udržování stability heterochromatinu a zdůrazňují dezorganizaci heterochromatinu jako potenciální determinant stárnutí člověka.

"Nakonec jsme se zeptali, zda by heterochromatinová dezorganizace mohla být společným znakem fyziologického stárnutí lidských kmenových buněk." Za tímto účelem jsme porovnali hladiny heterochromatinových značek v MSC primárních zubních dřeně odvozených od šesti mladých (7–26 let) a šesti starých (58–72 let) jedinců (obr. S10I a tabulka S4) (20) . Výrazná downregulace proteinu WRN spojená se snížením hladin H3K9me3, HP1α, SUV39H1 a LAP2β v MSC odvozených od starých jedinců (obr. 4E). Specifické změny heterochromatinu proto mohou být základem jak patologického, tak fyziologického stárnutí mezenchymálních kmenových buněk.

V souhrnu jsme zjistili, že protein WRN, kromě své role v opravě DNA, funguje také jako zajištění stability heterochromatinu (obr. S11). Naše výsledky odhalují, že progresivní dezorganizace heterochromatinu pozorovaná u MSC s nedostatkem WRN je základem buněčného stárnutí, ale k prozkoumání jeho role během fyziologického stárnutí jsou zapotřebí rozsáhlejší studie. “

Wernerův syndrom je rychle stárnoucí choroba, která se objevuje kolem puberty a vede k důkladnému stárnutí lidí kolem 45 let & gt & gt

Wernerův syndrom je způsoben nesprávným zkrácením proteinu WRN, takže je příliš krátký na to, aby správně vykonával svou práci při zachování statusu diferenciace lidských kmenových buněk.

Wernerův syndrom je velmi podobný normálnímu stárnutí. Tito pacienti mají všechny klasické známky stárnutí, ale mají také některé mimořádně vzácné formy onemocnění, což vedlo vědce k tomu, aby se pokusili tvrdit, že to nebylo skutečné stárnutí. Pacienti s WS jsou postiženi několika vzácnými druhy rakoviny a také běžnými procesy stárnutí.

Domnívám se, že přebytek vzácných nádorových onemocnění a dalších zvláštností spojených s WS není způsoben jediným zkráceným proteinem, který způsobuje všechny rysy normálního stárnutí, ale spíše nesprávným fungováním DNA helikázy vytvořené 6 identickými, ale defektními WRN helikázami podjednotky. Protože správné fungování DNA helikázy je nutné pro správnou údržbu a opravu DNA, není překvapující, že defektní helikázy by byly spojeny s různými zvláštními formami rakoviny.

(Pokud je mi známo, zkrácený protein WRN, který se nachází v normálně stárnoucích a stárnoucích buňkách, musí být ještě objeven-ale předpovídám, že to jednou přijde).

Zkrácený diferenciační/helikázový protein nacházející se ve Wernerově syndromu je svým pojetím podobný nemoci zvané progeria, která útočí na malé děti od narození a mění je na velmi staré skleslé jedince do 12 let věku, kde obvykle umírají na srdce onemocnění nebo ateroscelóza. Progeria je také způsobena zkráceným proteinem, proteinem Lamin A, což je protein, který se nachází v jaderném obalu uvnitř buňky. Navrhl jsem, aby progeria rekapitulovala mnoho symptomů stárnutí pozorovaných vyšší rychlostí u normálně stárnoucích mužů.

Zkrácený protein Lamin A způsobí, že obal, který obklopuje DNA v jádru, se zdeformuje & gt & gt

Normální jádro Progeria Nucleus

Co není tak dobře známé, je to, že protein progeria Lamin A má 2. funkci vazby na DNA, aby fungoval jako transkripční faktor, který umlčí různé geny tak, aby různé buňky udržely svou diferenciaci se správným profilem genové exprese (např. že kožní buňka zůstává kožní buňkou tím, že určitý soubor genů umlčí).

Viz AKTUALIZACE #12 na konci tohoto článku- ukazuje se, že lamin A není exprimován v indukovaných pluripotentních kmenových buňkách (nediferencovaných buňkách) a jádro těchto nediferencovaných buněk vypadá hodně jako jádro v progériových buňkách! To dává další váhu myšlence, že stárnutí je způsobeno ztrátou buněčné diferenciace.

Ukazuje se, že tento zkrácený protein Lamin A není jedinečný pouze pro progerické děti, ale je také vidět u normálního stárnutí ve vyšším věku u normálních dospělých! Nachází se v senescentních buňkách u normálních lidí- existuje na to řada studií, například & gt & gt & gt

Publikováno online 2007 5. prosince.

Mutantní forma laminu A, která způsobuje Hutchinson-Gilford Progeria, je biomarkerem buněčného stárnutí v lidské kůži

Abstrakt Hutchinson-Gilfordův syndrom progerie je vzácná porucha charakterizovaná zrychleným stárnutím a předčasnou smrtí, často z mrtvice nebo ischemické choroby srdeční. 90% případů HGPS nese LMNA Mutace G608G (GGC & gtGGT) v exonu 11 LMNA, aktivace donorového místa sestřihu, které vede k produkci dominantní negativní formy proteinu lamin A, označovaného progerin. Screening 150 kožních biopsií od nepostižených jedinců (novorozenců do 97 let) ukázal, že k podobné sestřihové události dochází in vivo na nízké úrovni v kůži v každém věku. Zatímco progerinová mRNA zůstává nízká, protein se s věkem hromadí v kůži v podskupině dermálních fibroblastů a v několika terminálně diferencovaných keratinocytech. Progerin-pozitivní fibroblasty se lokalizují poblíž bazální membrány a v papilární dermis pokožky mladých dospělých, jejich počet se však zvyšuje a jejich distribuce dosahuje hluboké retikulární dermis u starší pokožky. Naše zjištění to dokazují exprese progerinu je biomarkerem normálního buněčného stárnutí a mohou být potenciálně spojeny s terminální diferenciací a stárnutím u starších jedinců. "

V obou případech Wernerova syndromu a progerie tedy zjistíme, že zkrácený protein, který se používá k diferenciaci buněk, je defektní a není schopen řádně plnit svou úlohu při zachování diferencovaného stavu buňky.

Co se tedy dalo z těchto skutečností předpovědět?

Toto stárnutí není způsobeno ničím jiným než tím, že buňky ztrácejí svou diferenciaci nebo se stávají nediferencovanými, jak uvádím v názvu tohoto článku. Ve skutečnosti to mělo být předpovězeno již dávno po studiu Wernerova syndromu a progerie. Tato předpověď mohla být snadno provedena v roce 2014 a pravděpodobně dříve poté, co vyšly studie, které ukazují, že protein Lamin A se podílel na udržování buněčné diferenciace v kmenových buňkách.

Viz & gt Gerontologie. 201460 (3): 197-203. Epigenetické zapojení do syndromu Hutchinson-Gilford progeria: mini-přehled

Vezměte si například kožní buňku, protože ztrácí faktory, které potlačují geny, které se netýkají toho, že jsou kožní buňkou, začne buňka přijímat stále neobvyklejší (nediferencovaný) fenotyp.

Pokud by proces pokračoval dostatečně dlouho, kožní buňka by byla nakonec nerozpoznatelná. V některých ohledech byste mohli říci, že se kožní buňka vrací do svého nediferencovaného, ​​dřívějšího (mladšího) stavu, ale nezdravým způsobem, který nakonec zabíjí nositele těchto nediferencovaných buněk v celém těle. Protiintuitivně se zdá, že škodlivé stárnutí je ve skutečnosti způsobeno tím, že buňky jsou mladší, méně diferencované, spíše jako embryonální kmenové buňky!

Ve svém příspěvku z roku 1998 jsem se domníval, že primitivnější organismy na počátku evoluce se pravděpodobně reprodukovaly tímto způsobem- citát-

“ V tomto bodě evoluce došlo pravděpodobně k reprodukci prostřednictvím partenogeneze a možná úplné disociace mnohobuněčného organismu na nesčetné množství jednobuněčných, klonálních spór v neomezeném prostředí, což by poskytlo velkou reprodukční výhodu. ”

A ukazuje se, že na Zemi stále existují zvířata, která se dokážou reprodukovat tímto způsobem ... vezměte si například nesmrtelnou medúzu:

Z National Geographic Magazine-

Jak se z medúzy stane “Nesmrtelný ”

“ Turritopsis obvykle reprodukuje staromódní způsob, setkáním volně plovoucích spermií a vajíček. A většinou také umírají staromódně. Když ale dojde k hladovění, fyzickému poškození nebo jiným krizím, “ namísto jisté smrti, [Turritopsis] transformuje všechny své stávající buňky do mladšího stavu, ” uvedla autorka studie Maria Pia Miglietta, výzkumná pracovnice Pennsylvania State University. Medúza se promění v cystu podobnou blobům, která se poté vyvine v kolonii polypů, v podstatě první fázi života medúzy. Buňky medúzy a#8217 jsou v tomto procesu často zcela transformovány. Ze svalových buněk se mohou stát nervové buňky nebo dokonce spermie nebo vajíčka. Díky asexuální reprodukci může výsledná polypová kolonie plodit stovky geneticky identických medúz - téměř dokonalé kopie původního dospělého. ”

Zdá se, že náš program lidského rozvoje/ stárnutí rostoucí diferenciace a poté diferenciace diferenciace se pravděpodobně vyvinul z této starodávné formy reprodukčního systému. Namísto toho, aby se člověk rozpustil do 30 bilionů identických klonálních spór, aby se reprodukoval (což by se dalo očekávat, pokud by evoluční sobecká genová teorie byla jediným způsobem, jak evoluce fungovala), místo toho ztrácíme buněčnou diferenciaci způsobem, který škodí a nakonec zabíjí. Mohli bychom zajít tak daleko, abychom řekli, že stárneme stárnutím z odlišného hlediska!-mluvte o nečekaném závěru!

Pokud je tento koncept správný, pak můžeme očekávat, že s přidáním řady zdravých transkripčních faktorů zpět do starší buňky bude možné ji učinit mladší, a to se skutečně prokázalo. Vše, co bylo zapotřebí, byly čtyři transkripční faktory známé jako faktory Yamanaka, které dramaticky zvrátily stárnutí v buňce. První experiment s faktory Yamanaka vzal dospělou buňku a přeprogramoval ji až do embryonálního stavu. Později jen podrobili dospělou buňku přechodnému vyjádření faktorů Yamanaka a dokázali buňku výrazně omladit, ale nevrátili se až do stavu embrya.

Viz & gt buňka. 2016 15. prosince 167 (7): 1719–1733.e12. In Vivo Zlepšení věkových charakteristických znaků částečným přeprogramováním

"Stárnutí je hlavním rizikovým faktorem mnoha lidských chorob." Studie in vitro prokázaly, že buněčné přeprogramování na pluripotencii obrací buněčný věk, ale změna procesu stárnutí prostřednictvím přeprogramování nebyla in vivo přímo prokázána. Zde uvádíme, že částečné přeprogramování pomocí krátkodobého cyklického vyjádření Oct4, Sox2, Klf4, a c-Myc (OSKM) zlepšuje buněčné a fyziologické znaky stárnutí a prodlužuje životnost v myším modelu předčasného stárnutí. Podobně exprese OSKM in vivo zlepšuje zotavení z metabolických onemocnění a poranění svalů u starších myší divokého typu. Zlepšení fenotypů spojených s věkem epigenetickou remodelací během buněčného přeprogramování zdůrazňuje úlohu epigenetické dysregulace jako hybného mechanismu stárnutí savců. Zřízení platforem in vivo k modulaci epigenetických značek spojených s věkem může poskytnout další pohled na biologii stárnutí. “

Dobře, takže zde je další malá předpověď, kterou lze provést:

Pokud je stárnutí způsobeno ztrátou diferenciace ve vašich buňkách, pak by se dalo očekávat, že se geny produkující transkripční faktory vypnou. Když se vrátíme k Wernerovu syndromu a progerii, očekáváme také uvolnění nějakého druhu proteinu souvisejícího se stárnutím, který vede ke zkráceným diferenciačním proteinům, jako je Lamin A a WRN.

Jaký druh genového produktu bychom hledali, který zkracuje diferenciační proteiny? Nejjednodušší způsob zkrácení proteinů by nebyl na úrovni bílkovin, ale spíše na úrovni mRNA. Produkce proteinů spočívá v tom, že se geny v naší DNA čtou a kopírují do velmi podobné molekuly zvané mRNA, která je téměř identická s DNA, s výjimkou použití páru bází Uracil místo thyminu v GCAT abecedě vaší DNA. Jediným rozdílem mezi Uracilem a thyminem je jediná methylová skupina (CH3), která se nachází připojená k 5 ‘uhlíku v tyminu, ale pouze 5 H je připojeno k 5’ uhlíku v uracilu.

Predikce: Měl by existovat nějaký druh proteinu, který zkracuje transkripty mRNA na nevhodných místech, která se s věkem zvyšují, což způsobí poškození různých diferenciačních proteinů, jako je WRN a Lamin A. To by bylo mnohem snazší než řezání proteinů poté, co již byly vytvořeny. Ve skutečnosti jsem tuto předpověď udělal dvojici vědců, kteří byli schopni omladit staré myši odstraněním poloviny jejich krevní plazmy a jejím nahrazením fyziologickým roztokem a albuminem. Navrhl jsem, aby hledali stárnoucí RNA-ase, která pobíhala po zkracování transkriptů mRNA na nevhodných místech-nikdy jsem o nich neslyšel.

Jak již bylo zmíněno dříve, zdá se, že LARP1 odpovídá popisu tohoto hypotetického proteinu! Má velmi jedinečnou sekvenci, která je specifická pro vazbu na transkripty RNA. Ve vysoké míře se vyskytuje u rakoviny. Oběti Wernerova syndromu trpí vysokou mírou běžné rakoviny také- štěpí LARP1 protein WRN, což vede k rakovině?

Závěry, které můžeme z této úžasné nové studie vyvodit, jsou tedy tyto:

  1. Protože velký soubor genů vypnutých methylací během procesu stárnutí (stejně jako upregulovaný gen LARP1 (skutečný gen stárnutí)) jsou primárně stejné u všech druhů savců velmi, velmi, silně naznačuje, že stárnutí se vyvinulo a je vysoce konzervované. To je v úplném rozporu s moderní mainstreamovou evoluční teorií, která hlásá, že stárnutí se nikdy nemohlo vyvinout, protože je pro jednotlivce špatné a omezuje šíření jeho individuálních genů. Pro většinu moderních teoretiků stárnutí si myslí, že vyvinutý program stárnutí je něco podobného stroji s věčným pohybem, zcela nemožné. Ve skutečnosti to byl kdysi citát Aubreyho De Graye v jeho druhém dokumentu o tom, jak bylo programované stárnutí nemožné.

Viz & gt Omezení kalorií, doba po reprodukci a programované stárnutí: prosba o přísnost. Gray AD, Ann N Y Acad Sci. 2007 Listopad 1119: 296-305.

Vezměte prosím na vědomí, že jsem nevyškrtl hormonální/neuroendokrinní teorii stárnutí …, která je stále platná a bude shledána jako předřazený regulátor programované ztráty buněčné diferenciace především díky velkému/dramatickému nárůstu LH, FSH po 50 letech a hCG se současným dramatickým poklesem vrcholů melatoninu v noci, dhea, pregnenolonu a progesteronu.

Je zajímavé, že bylo zjištěno, že melatonin dokáže všechny druhy úžasných věcí, jako je zvrácení nedávné menopauzy (pravděpodobně kvůli schopnosti melatoninu potlačit LH a FSH), prevence progrese Alzheimerovy choroby, dramaticky se zvyšuje během kalorického omezení, působí jako antikoncepce u žen 75 mg za noc a dokonce prodloužení života myší o 20%. Dokážu si snadno představit, že melatonin má nějakým způsobem ústřední úlohu při udržování methylovaného stavu cirkadiánních rytmů a Alzheimerových genů, které se během stárnutí hypomethylovaly (Horvath je našel v malé skupině genů, které se aktivují stárnutím spolu s LARP1).

Rychlé vyhledávání v Med Med & & 8220 melatonin AND DNA AND methylation ” vám poskytne 96 studií, z nichž většina ukazuje, že melatonin je složitě spjat s methylací DNA, a pokles melatoninu s věkem může být důvodem globálního hypomethylovaného stav DNA u starších osob. Studie s názvy jako>>> Melatonin a sirtuiny: A “ ne tak neočekávaný ” vztah. Nebo Neuroendokrinní stárnutí předchází perimenopause a je regulováno metylací DNA Melatoninem indukovaná demetylace antioxidačních genů zvyšuje antioxidační kapacitu prostřednictvím RORalpha v kupovitých buňkách prepubertálních jehňat „Melatoninem zprostředkovaný vývoj buněk kumulus ovcí, pravděpodobně regulací methylace DNA, Melatonin obnovuje pluripotenci dlouhodobě kultivovaných embryonálních kmenových buněk prostřednictvím regulace m6A RNA závislé na melatoninovém receptoru (faktorů Yamanaka) nejsou neobvyklé.

Existuje řada studií, které ukazují, že progesteron, testosteron a estrogen mají dramatické účinky na methylaci DNA.

Rovněž jsem nepřeškrtl telomérovou teorii stárnutí. Tato teorie se však stává jen podmnožinou ztráty teorie buněčné diferenciace stárnutí v těch telomerách, když jsou dlouhé, přeloží se zpět na kódující DNA a potlačí různé geny, pravděpodobně stárnoucí geny. Jak se telomera zkracuje, tyto geny jsou pak exprimovány. Toto se nazývá efekt polohy telomer. (Možná, že geny, které když jsou exprimovány, vedou k methylaci/potlačení těchto 36 genů transkripčního faktoru, lze nalézt zde-(Nicméně o tom trochu pochybuji, protože se ukázalo, že myši nemají žádné příznaky stárnutí poté, co je jejich telomerázový gen vyřazeny a mají neustále zkracující telomery. Jediné stárnoucí symptomy, které se objevují u experimentálních myší, se vyskytují ve 4. generaci, když začnou vykazovat šedivění vlasů, alopecii a neplodnost-viz DePinho)).

Horvath také poznamenal, že některé další geny, které byly hypermethylované, a proto byly vypnuty, byly skupinou genů zapojených do cirkadiánního rythymu. To mi naznačuje spojení s melatoninem a dalšími hormony, které se mění po celý den. Poznamenal další sadu genů, které se podílejí na vzniku Alzheimerovy choroby, které také ztrácejí methylaci a jsou výraznější. (To by mohlo vysvětlovat, proč se melatonin zdá tak účinný při zastavení progrese Alzheimerovy choroby).

Tato studie si tedy samozřejmě klade důležitou otázku-Jaký je účel evoluce programovaného stárnutí a jak by se mohl vyvíjet?

Stručný článek o tom, jak může evoluce zvolit PRO stárnutí & gt & gt

Nebo podrobnější knihu na téma & gt & gt & gt & gt

Aktualizace 1. Nedávná studie, kde bylo 50% krevní plazmy myší nahrazeno fyziologickým roztokem a albuminem, což vedlo k dramatickému omlazení myší dříve, zde byla naznačena jako možná způsobená redukcí proteinu LARP1. Co když však protein LARP1 necirkuluje v krvi, ale nachází se pouze uvnitř buněčného jádra? Co jiného by mohlo být odstraněno z krve, které zastavuje proces stárnutí a umožňuje omlazení? Co třeba 50% snížení cirkulujících gonadotropinů LH, FSH a hCG? Jedná se o hormony podporující stárnutí, které se s věkem zvyšují o stovky procent a u žen a mužů po 50 letech dokonce až o 1 000%.

Aktualizace 2. Je zajímavé si všimnout, jak děti často vypadají tak podobně, protože nejsou plně “diferencované ”. Jsou mnohem jedinečnější a odlišnější jako děti a dospělí. Ale pak si vzpomeňte na starší lidi, kteří vypadají, že vypadají velmi podobně? Je to příklad zisku, pak ztráty buněčné diferenciace projevující se fyzickým vzhledem?


Aktualizace 3- Zdá se, že tento systém stárnutí je jakýmsi případem antagonistické pleiotropie (AP). Jak? Je to nový druh AP, kde něco, co bylo dobré pro vaše vzdálené předky (rozpuštění organismu na miliony miliard jednobuněčných klonů, z nichž každý může vyrůst v nového dospělého), se z evoluční perspektivy vyvine v něco, co je špatné pro modernější potomci rodových druhů. Starověký, dramaticky plodný systém reprodukce se vyvinul v něco, co nyní zabíjí jednotlivce v naprogramovaném čase.

Aktualizace 4– Pokud jsou progeria a Wernerův syndrom#8217 s projevy špatně fungujícího vývojového/diferenciačního programu, můžeme učinit dvě velmi důležitá pozorování:

  1. Geny umlčené lamin a proteinem, který je defektní v progérii, jsou s největší pravděpodobností stejné geny, které řídí vývojové změny, kdy se kojenec vyvine do prepubescentního mladistvého. (Mějte na paměti, že progerie začíná narozením) a
  2. Geny umlčené proteinem WRN, který je defektní u Wernerova syndromu, jsou s největší pravděpodobností geny, které řídí vývojové změny, kdy se předpubertální mladistvý vyvine v plně sexuálně vyvinutého/diferencovaného plodného dospělého. (Pamatujte, že Wernerův syndrom nezačne fungovat, dokud nezačne puberta).

Aktualizace 5- Po celá desetiletí, ne -li století, museli evoluční biologové a gerontologové, aby si udrželi iluzi, že stárnutí není naprogramováno a nebylo vybráno, skrývat určitá fakta, která právě křičela “ je naprogramováno! ”. Dvě nemoci, které jsou hlavním tématem tohoto článku, Wernerův syndrom a progerie, se stále znovu a znovu označují jako “ne skutečných příkladů stárnutí ”, protože jsou způsobeny genetickými mutacemi a při srovnání mají několik rozdílů k pravidelnému stárnutí. To platí zejména v případě Wernerovy choroby, kde 50letá žena bude vypadat téměř identicky s normálně stárnoucí 85 nebo 90letou ženou! Vzhledem k tomu, že u pacientů s Wernerovým syndromem je vyšší výskyt některých vzácných nádorových onemocnění, vědci z minulosti se spoléhali na tento kachen, že prohlásili, že Wernerův syndrom není případ zrychleného programovaného stárnutí. S naprogramovanou ztrátou teorie buněčné diferenciace stárnutí můžeme konečně skoncovat s tímto předstíráním.

Další do očí bijící skutečnost, že výkřiky “aging jsou naprogramovány ”, je existence semarparativního stárnutí. Nejslavnější příklad spočívá v rychlém stárnutí a smrti pacifického lososa bezprostředně po chovu kolem věku tří let. Když je losos pacifický kastrovaný, může žít 7 a více let. Jak to bylo vysvětleno pomocí dalších teorií stárnutí minulosti? Jednoduše řečeno, semelparózní stárnutí není skutečnou formou stárnutí a lze jej ignorovat! Dlouho se předpokládalo, že rychlé stárnutí a smrt tichomořského lososa bylo způsobeno jeho obrovským vynaložením energie a velkým množstvím zdrojů vynaložených na cestování po dlouhé cestě z oceánu do jeho rodiště, kde se rozmnožuje. Někteří tvrdili, že losos právě zemřel vyčerpáním. Jiní uvedli o něco méně jednoduchý případ a navrhli, aby hormonální změny, ke kterým došlo během velkého výletu lososa, vedly k velmi vysokým hladinám stresového hormonu kortizolu. Údajně je to zabíjelo, i když zvýšení kortizolu přichází dlouho předtím, než se rozmnožují.

Nedávno Craig Atwood provedl studii o změnách pro-aging hormonů LH a FSH různých druhů včetně semelparního lososa. I když zjevně nemohl najít žádné údaje o změnách hladin LH v lososovi, zjistil, že hladiny FSH raketově stoupají o 4500% po reprodukci ve srovnání s dokonce vysokou úrovní dosaženou u lidí po 50 letech, což je asi 500% nárůst.

Chtěl bych Craiga upozornit, že existuje studie z roku 1998 o hormonálních změnách u lososa, která také ukazuje, že hladiny LH raketově rostou. Biol Reproduction 1998 Mar58 (3): 814-20. B. Borg a kol. al.

V konečném důsledku tedy vidíme, že semelparózní druhy již nemusí být zařazeny do zvláštní kategorie a skryty a ignorovány, protože nesouvisí s normálním stárnutím. Spíše nyní poskytují poněkud typický případ programovaného stárnutí poháněného postprodukčním dramatickým nárůstem FSH a LH pozorovaným také u lidí a většiny ostatních zvířat od ryb přes savce po ptáky atd. Losos je neobvyklý pouze rychlostí stárnou a do jaké výšky mohou dosáhnout jejich hladiny LH a FSH.

Nyní se tento opravdu dostává do plevele této teorie-pravděpodobně není vhodný pro příležitostné čtenáře:

Je zajímavé zvážit tyto dva souhrny týkající se menopauzy, hormonů a methylace & gt

Význam

V rámci evolučního rámce jsou stárnutí a reprodukce neodmyslitelně spojeny. Přestože laboratorní i epidemiologické studie pozorovaly souvislosti mezi načasováním reprodukční senescence a dlouhověkostí, není dosud známo, zda se rozdíly ve věku menopauzy odrážejí v biomarkerech stárnutí. Pomocí našeho nedávno vyvinutého biomarkeru stárnutí, „epigenetických hodin“, jsme zkoumali, zda je věk v menopauze spojen s epigenetickým stářím krve, slin a bukálního epitelu. Toto je definitivní studie, která ukazuje souvislost mezi věkem menopauzy a biologickým stárnutím (měřeno pomocí epigenetických hodin). Naše výsledky také naznačují, že menopauza může urychlit proces epigenetického stárnutí v krvi a že věk v menopauze a zrychlení epigenetického věku sdílejí společný genetický podpis.

Stárnutí neurobiolu 2019 únor74: 213-224.

Neuroendokrinní stárnutí předchází perimenopauze a je regulováno methylací DNA
Abstraktní

Perimenopauza označuje zahájení ženské reprodukční senescence. Věk nástupu je pouze 47% dědičný, což naznačuje, že tento přechod endokrinního stárnutí regulují další faktory než dědičnost. Abychom tyto faktory objasnili, charakterizovali jsme transkripční a epigenomické změny napříč endokrinním stárnutím pomocí krysího modelu, který rekapituluje charakteristiky lidské perimenopauzy. RNA-seq analýza odhalila, že stárnutí hypotalamu předchází nástupu perimenopauzy. V hypotalamu globální methylace DNA klesala s věkem i reprodukční senescencí. Epigentická analýza v celém genomu odhalila změny v methylaci DNA v genech potřebných pro hormonální signalizaci, glutamátovou signalizaci a melatoninovou a cirkadiánní cestu. Specifické epignetické změny v těchto signálních cestách poskytují vhled do původu neurologických symptomů spojených s perimenopauzou, jako je nespavost. Ošetření 5-aza-2 ′-deoxycytidinem, inhibitorem DNA-methyltransferázy-1, urychlilo přechod k reprodukční senescenci/ zatímco suplementace methioninem, prekurzorem S-adenosylmethioninu, opožděný nástup perimenopauzy a endokrinní stárnutí. Souhrnně tato data poskytují důkazy o kritickém období ženského neuroendokrinního stárnutí v mozku, které předchází selhání vaječníků a že methylace DNA reguluje dobu přechodu perimenopauzy do menopauzy.

Jakmile si evoluční biologové uvědomí, že evoluci pohání něco jiného než sobecký gen, jakmile si uvědomí, že existují evoluční síly, které také omezují šíření individuálních genů pro dobro druhů, které popisuji ve svém článku & #8220 Stárnutí sexu a zesilovače, jak si je Evoluce vybírá téměř po celou dobu ” lze snadno vysvětlit mnoho přetrvávajících tajemství evoluce. Zde je například velká část kapitoly o homosexualitě v mé knize “ Co Darwin nemohl vidět- chybějící polovina teorie ”:

KAPITOLA 6: Šestý díl skládačky-homosexualita u zvířat a lidí

Člověk by si myslel, že každý, kdo bude bránit prvenství sobeckého genu jako hlavní hybné síly celé evoluce, bude mít jakési rozumné vysvětlení, jak by se mohlo něco tak rozšířeného, ​​jako je lidská homosexualita, vyvíjet.

Homosexualita je stav, kdy vlastník homosexuálního znaku, pokud bude ponechán pouze přírodě, rozhodne se nikdy nemít sex s opačným pohlavím, a tedy nebude mít žádné potomstvo a nepředá jediný gen do genofondu! Přesto lidská homosexualita existuje a přetrvává po celou historii.

Jistě to musí být pro sobecké promotéry genů obtížnější vysvětlit než sex. Reproduktor alespoň při sexu předá polovinu svých genů. Zde musí sobecký genista vysvětlit, jak se vyvinul, že někdo předává BEZ ŽÁDNÝCH GENŮ! Vzhledem k velmi obtížnému problému, který je zde třeba vyřešit, je téma homosexuality evolučními biology z velké části ignorováno.

Richard Dawkins, odvážný jako on, se alespoň pokusí o vysvětlení ve videu na YouTube z roku 2015. Níže s vámi sdílím odkaz. Pokud se chcete dobře zasmát, koukněte na to. Nesměji se samotnému Dawkinsovi, jen tomu, že se pokouší splnit nemožný úkol vysvětlit homosexualitu z pohledu sobeckého genu.

Otázky Darwinova dne 2015: #4 Jak evoluce vysvětluje homosexualitu?

Po shlédnutí tohoto se domnívám, že by se Dawkins mohl zdát, že se více zaměřuje na homosexualitu mužů než žen, a byl tak odvážný, že naznačoval, že kojenci krmení z lahve (předpokládám, že jsou muži) by je mohli více naklonit homosexuálům. Hádám, že si myslí, že sání gumové bradavky trénuje mladého chlapce, aby chtěl sát další výčnělky?

Biologové obecně mají tendenci diskutovat o evolučním hlavolamu homosexuality jako hlavně o lidském stavu. Díky jeho aplikaci pouze na lidi je tato skutečnost jedinečná a zvláštní kategorie, kterou lze ignorovat. Dělají to pořád. Menopauza a sebevražda jsou většinou biologů propagovány jako výjimky, které se týkají pouze lidí.

Ukázalo se, že lidé nejsou jediní, kde je homosexualita běžná.

Existují odhady, že bylo zdokumentováno až 1500 druhů homosexuálních jedinců! Pokud si jen rychle prohlédnete záznam homosexuality u zvířat na Wikipedii, získáte nejrůznější příklady.

Zdá se tedy, že homosexualitu nelze zařadit do jedinečné kategorie lidských výjimek, a biologové ji proto již nemohou ignorovat. Musí se to řešit tak, že se to pokusíme vyřešit z pohledu nadřazenosti sobeckého genu, který nás vede do jiné slepé uličky, z níž není cesty ven.

To, co záznam z Wikipedie nedokáže popsat, jsou podmínky ovlivňující těhotnou matku budoucích homosexuálních potomků.

Řada studií na hlodavcích ukázala, že pokud v určitém období těhotenství těhotnou matku stresujete, bude mít tendenci rodit homosexuální muže a promiskuitní samice a menší počet homosexuálních žen.

Co nám to říká z pohledu VELKÉHO OBRAZU? Co způsobuje stres? Příliš mnoho blízkých setkání s predátory. To se docela snadno hodí do VELKÉHO OBRAZU většiny nevysvětlitelných biologických jevů jako obrana vyvíjející se predace.

Jak se homosexuální potomstvo brání predaci? Mít homosexuální potomky je forma kontroly porodnosti pro matky, které jsou evolucí považovány za nezpůsobilé v přítomnosti predace. Stres z predátorských setkání, pokud je dostatečně extrémní, může zabít matky a jejich nenarozená miminka. Pokud je stres méně extrémní, může to vést k homosexuálním potomkům, které je třeba ošetřovat po relativně významnou dobu. Ošetřování brání matce stát se plodnou pro páření. V určitém smyslu je tedy mít homosexuální potomky pouze přirozenou formou kontroly porodnosti pro matky, které jsou kvůli stresu vnímány jako dočasně „nezpůsobilé“.

Považujme případ ženských potomků stresovaných matek za promiskuitnější než potomky nestresovaných matek. To také dobře ladí s VELKÝM OBRÁZKEM, protože promiskuitní ženy, které mají potomky z více mužů než spojování s jediným, přidají do genofondu větší rozmanitost, než kdyby se celý život spárovala s jediným mužem. Jak uvidíme později, rozmanitost v genofondu je obranou před vyvíjející se predací, kterou evoluce hledá se všemi těmito tajemnými adaptacemi.

Nyní se dostáváme k lidem, existují nějaké důkazy, že stresování těhotných žen může způsobit, že se jejich mužští potomci narodí jako homosexuálové? Napsal jsem o tomto tématu ve svém článku z prosince 2000 publikovaném v lékařských hypotézách s názvem „Sex, králové a sérioví zabijáci a další vlastnosti vybrané ze skupiny“

Homosexualita: Kontrola porodu pro „nevyhovující“ matky?

Převládající evoluční teorie nemůže vysvětlit hádanku homosexuality. Současná teorie vyžaduje definovat homosexualitu jako evoluční nehodu, protože reprodukce homosexuálních potomků by se neočekávala. Je evoluce tak nedbalá, že sexuální preference 10% až 20% lidské populace (78) je prostě náhodná chyba přírody? A proč se také vyskytuje v celé říši zvířat z ovcí (79) dolů na krysy (80)? Pokud někdo přijme skupinový výběr jako realitu, účel homosexuality má jednoduché vysvětlení.

Různé studie ukazují, že když jsou krysy v určitém čase během těhotenství ve stresu, rodí samce, kteří projevují ženské chování, a samice, které jsou mužnější. (81). (Literatura je v tomto ohledu u mužů poměrně průkazná, ale údaje o ženách jsou poněkud nejednoznačné. Některé samice potomků stresovaných potkanů ​​také vykazují promiskuitnější chování při páření). Stres zvyšuje hladiny kortizolu u potkanů ​​a předchozí dokument odkazoval na studie, které ukazují, že kortizol podle všeho opačně ovlivňuje pohlavní hormony u žen a mužů, o kterých budeme předpokládat, že se vztahují i ​​na krysy.

Pokud stres vyvolává vysoké hladiny kortizolu u matky během těhotenství a kortizol dosáhne vyvíjejícího se embrya, mohou být změněny endogenní embryonální pohlavní hormony. Hladiny testosteronu a estradiolu v mužských a ženských embryích mohou být sníženy. Snížení embryonálních pohlavních hormonů pravděpodobně ovlivňuje vývoj sexuality mozku. Ukázalo se, že prenatální stresem indukované feminizaci krysích samců je zabráněno léčbou perinatálním androgenem (82).

Studie ukázaly, že lidské ženy, mužští transsexuálové a homosexuálové sdílejí podobnosti v určitých mozkových strukturách, které se liší u heterosexuálních mužů (83, 84). Také se věří, že při vývoji mozku plodu je k vytvoření „mužského mozku“ nezbytný DHT získaný z testosteronu (85). Podobně bychom mohli předpokládat, že expozice estradiolu vytváří „ženský mozek“ feminizací některých mozkových struktur. Pokud stresem vyvolaný nárůst kortizolu u matky potlačí testosteron nebo estradiol embrya, pak by mohlo dojít k homosexuálnímu potomstvu jakéhokoli pohlaví. Je zajímavé, že někteří vědci zjistili, že ve velké skupině homosexuálů dotazovaných v Německu se během válečných let 1941 až 1947 narodilo mnohem více lidí než před tímto stresovým obdobím nebo po něm a vrchol porodu nastal v letech 1944-1945 (86).

Proč by evoluce vytvořila takový systém? Pokud je těhotná žena ve volné přírodě ve stresu, může to znamenat blízké setkání s predátory nebo nepřizpůsobení její skupině. Evoluce prostřednictvím skupinového výběru pravděpodobně vybrala skupiny, které odstraňují nebo brání šíření jejích „méně vhodných“ genů. Zatímco spontánní potrat nebo stresem vyvolaná kanibalizace jejích mláďat (což je u hlodavců běžné) je jednoduché řešení, samice by byla připravena znovu se rozmnožovat. Chytřejším a efektivnějším řešením je dát jí účinně sterilní potomstvo, které bude vychovávat a které jí zabrání v reprodukci mnohem déle, než kdyby byla bezdětná. Také pokud by skupinové přežití vyžadovalo reprodukci homosexuálních dětí, mohly by být homosexuální ženy nuceny k sexu dominujícími heterosexuálními muži. Homosexuální muži, kteří nemohli být nuceni, jsou stejně evolučně irelevantní, pokud existoval jediný heterosexuální muž.

Jediný pokus o evoluční vysvětlení homosexuality, který autor našel, byl ten, který navrhl, že by bylo vygenerováno homosexuální dítě mužského pohlaví, pokud by bylo prenatálně stresováno. Předpokládalo se, že stresorem je matka žijící v přeplněném prostředí. Homosexuální muž by se jako dospělý nereprodukoval, takže v době hladomoru by bylo méně vnoučat, a tím by se zvýšila pravděpodobnost přežití vnoučat (87). Člověk nemusí pracovat dlouho, aby našel protiargumenty této úvahy, ale je to kreativní pokus překonat hlavolam homosexuality a hraničit s použitím skupinového výběru jako argumentu. Je zde pouze odkazováno na ukázání obtíží, které existují při pokusu vysvětlit homosexualitu bez nestydatého přijetí nějaké formy skupinového výběru.

(Nedávná poznámka-o které později zjistíme, že se nejedná o skupinu, ale o ještě vyšší formu výběru nazývanou výběr druhů, kterou jsem upřesnil a vytvořil název „Výběr dravců“).

Je třeba se zamyslet nad zdánlivě vysokou úrovní lidské homosexuality. Bylo tolik matek během těhotenství vážně stresováno predátory nebo válkami? Nepravděpodobně. V tomto století byl však na lidi v epidemickém rozměru uvolněn zdroj umělého stresu: kouření cigaret. Nikotin z kouření vyvolává významné zvýšení hladin kortizolu. Pokud má těhotná žena genetickou predispozici nosit ve stresu homosexuální děti a během raného těhotenství kouří, může zvýšení kortizolu vyvolané nikotinem stačit k vyvolání homosexuality u jejích potomků. Tuto spekulaci lze snadno potvrdit nebo vyvrátit jednoduchou epidemiologickou studií.

  1. Prodejte R. Wells J. Wypij D. Prevalence homosexuálního chování a přitažlivosti ve Spojených státech, Velké Británii a Francii: výsledky národních populačních vzorků. Archiv sexuálního chování 24 (3). 1995. 235-248.
  2. Perkins A. Fitzgerald J. Moss G. Srovnání sekrece LH a receptorů estradiolu v mozku u heterosexuálních a homosexuálních beranů a ovcí. Hormony a chování zesilovače 29 (1). 1995. 31-41.
  3. Ferguson T. Alternativní sexuality v evoluci. Evoluční teorie 11 (1). 1995. 55-64
  4. Ohkawa T. Sexuální diferenciace sociální hry a kopulačního chování u prenatálně stresovaných samců a samic potkanů: vliv simultánní léčby tyrosinem během expozice prenatálnímu stresu. Nippon Naibunpi Gakkai Zasshi-Folia Endocrinolgica Japonica. 63 (7): 823-35, 1987 červenec.
  5. Dorner G. Gotz F. Docke W. Prevence demaskulizace a feminizace mozku u prenatálně stresovaných samců potkanů ​​perinatální androgenní léčbou. Experimentální a klinická endokrinologie. 81 (1): 88-90 1983 leden
  6. Swaab D. Gooren L. Hofman M. Pohlaví a sexuální orientace ve vztahu k hypotalamickým strukturám. Výzkum hormonů. 38 Suppl 2: 51-61, 1992.
  7. Zhou J, Hofman M. Gooren L. Swaab D. Rozdíl pohlaví v lidském mozku a jeho vztah k transsexualitě. Příroda. 378 (6552): 68-70, 1995 Listopad.
  8. Connolly P. Choate J. Resko J. Účinky endogenního androgenu na mozkové androgenní receptory opice plodu rhesus. Neuroendokrinologie. 59 (3): 27. března 1994
  9. Dorner G. et.al. Prenatální stres jako možný etiogenetický faktor homosexuality u lidských mužů. Endokrinologie.75 (3): 365-8, 1980 červen.
  10. 81.

-END Výňatek z mé práce z roku 1998-

(Přirozený homosexuál?)

Při hledání starých studií, které ukázaly prudký nárůst narození homosexuálů v Německu během 2. světové války (k tomu údajně došlo i v Anglii mezi těhotnými ženami, které se během německých bombových kampaní schovávaly v londýnských tunelech metra) článek o nové knize dr. Dicka Swaaba, známého neurologa, který je nejlépe známý pro svůj výzkum a objevy v oblasti anatomie a fyziologie mozku, zejména dopadu, který mají na mozek různé hormonální a biochemické faktory v děloze rozvoj. Kniha se jmenuje „My jsme naše mozky“ a předkládá kontroverzní „novou“ myšlenku, že homosexualita se vyskytuje v mozku plodů v lůně stresovaných matek.Rovněž poznamenává, stejně jako já ve svém článku z roku 2000, že kouření těhotných matek může vést k homosexuálním potomkům, protože nikotin stimuluje uvolňování stresového hormonu kortizolu a ve skutečnosti působí jako setkání predátorů, jak je vnímáno evolucí. Přidává některé nové důkazy o tom, že stres u matek způsobuje homosexualitu tím, že, jak by se dalo očekávat, poznamenává, že amfetaminy (také falešný stres) a různé další látky vedou k přemíře homosexuálních potomků.

O homosexualitě je to tedy vše. Pokud jsme se dozvěděli další fakt o evoluci, můžeme říci, že homosexualita zapadá do celkového obrazu takto:

-Homosexualita je kontrola porodnosti pro matky vnímané jako stresované evolucí, a proto pravděpodobně mají méně než optimální geny pro konkrétní prostředí. Účinně „sterilní“ dítě snižuje její potenciální příspěvek do genofondu tím, že jí brání otěhotnět během kojení, a investováním prostředků do sterilního dítěte, což také snižuje její celkový potenciální reprodukční výkon.

Ještě jedna věc-Dr. Dick Swaab, z nějakého důvodu dostává hrozby smrti od některých homosexuálů, kteří nemají rádi homosexualitu, zobrazováni jako patologie! Myslím, že si chtějí myslet, že je to volba. Ale když se zeptáte většiny gayů, rádi řeknou, že se tak narodili. Neposílejte mi proto prosím žádné výhrůžky smrtí, děkuji.

Jedna další věc, kterou jsem si všiml, je, že když se podíváte na velké skupiny buď homosexuálních mužů, nebo homosexuálních žen, muži si stále udržují svoji vyvinutou touhu vyniknout a upoutat na sebe pozornost, zatímco skupiny lesbiček působí více jako maskované samice jiných druhů, které touží a vyvinuly se, aby se vyhnuly pozornosti. Můžete také provést hrubý test této myšlenky vyhledáním obrázků Google pro skupinu homosexuálů a poté pro skupinu lesbiček a uvidíte rozdíl. Většina obrázků je v následujících řádcích: (viz obrázky v knize).

Aktualizace 9- to je dobré!

Při výzkumu mé práce z roku 1998- Evoluce stárnutí nového přístupu ke starému problému biologie

Studoval jsem všechny choroby zrychleného stárnutí progerie, segmentální stárnutí způsobená různými mitochondriálními defekty, ataxia telangiectasia (AT), Cockayneův syndrom (CS), xeroderma pigmentosum (XP) a Wernerův syndrom#8217s a porovnal jsem je s ohledem na to, jaké stárnutí symptomy, které měli zrychleným tempem …, a vytvořili tabulku k jejich porovnání! (viz tabulka níže). Ymůžeme to nazvat periodickou tabulkou symptomů zrychleného stárnutí.

Označil jsem Wernerův syndrom jako dominantní systém stárnutí, který kopíroval a kontroloval všechny ostatní systémy stárnutí- uvidíte proč, když si prostudujete tabulku- ale v zásadě proto, že WS ukazuje všechny příznaky normálního stárnutí člověka, zatímco jiné nemoci rychlého stárnutí prostě ukázat segment ..

Ukazuje se, domnívám se, vzhledem k souvislosti mezi vývojem a stárnutím, kterému nyní díky Horvathovi rozumíme, že normální protein syndromu Wernerova syndromu je zjevně také koordinátorem a hlavním regulátorem všech ostatních vývojových genů a transkripčních faktorů. Protein WRN nedělá veškerou práci sám, zjevně využil downstream transkripční/diferenciační faktory a říká jim, kdy je třeba je zapnout a vypnout. WRN je hlavní regulátor vývoje.

WRN nějakým způsobem řídí, jak a kdy protein lamin A vypíná různé geny ve své působnosti, stejně jako normální proteiny, které jsou defektní v mitochondriálních chorobách, AT, CS a XP. Wrn jim všem říká, co a kdy mají dělat.

Také nyní odhaluje, jak věřím, hlavní plán toho, jak je vývoj regulován a organizován, jak brzy uvidíte- měl jsem o tom tušení, když jsem vytvořil stůl, ale nikdy jsem to neformuloval. Držte si klobouky …zde to přichází & gt & gt


Závěry

Ukázali jsme, že zavedené pluripotentní buňky jsou neoplastické, pokud jsou přítomny po době, kdy je pluripotence normálně vypnuta, tj. Ve fázích organogeneze. Ukazujeme také, že reaktivace Oct4 nebo Oct4 a Nanog po vypnutí pluripotence nestačí k reaktivaci pluripotency in vivo, a vyžaduje další signály z buněčného mikroprostředí. V budoucnu bude zajímavé určit, zda se místa, na kterých je přirozeně přítomna buď signalizace Activin/Nodal/Fgf nebo LIF/BMP, shodují s místy, na kterých teratomy spontánně vznikají u myší a lidí.


Účinky triklosanu na faktory pluripotence a vývoj myších embryonálních kmenových buněk a zebrafish

Triclosan (TCS) představuje potenciální rizika pro reprodukci a vývoj vzhledem k jeho vlastnostem narušujícím endokrinní systém. Mechanismus účinků TCS na raný embryonální vývoj je však málo známý. Embryonální kmenové buňky (ESC) a embrya zebrafish poskytují cenné modely pro testování toxických účinků chemických látek v životním prostředí na ranou embryogenezi. V této studii byly myší embryonální kmenové buňky (mESC) akutně vystaveny TCS po dobu 24 hodin a poté byla hodnocena obecná cytotoxicita a účinek TCS na pluripotenci. Embrya zebrafish byla navíc vystavena TCS od 2 do 24 hodin po oplodnění (hpf) a byla hodnocena jejich morfologie. V mESC bylo barvení alkalickou fosfatázou po ošetření nejvyšší koncentrací TCS (50 μM) významně sníženo. Ačkoli úrovně výrazu Sox2 mRNA nebyly změněny, hladiny mRNA 4. října a Nanog ve skupinách léčených TCS byly významně sníženy ve srovnání s kontrolami. Kromě toho hladiny bílkovin 4. října, Sox2 a Nanog byly významně sníženy v reakci na léčbu TCS. MicroRNA (miR)-134, inhibitor exprese markerů pluripotence byl významně zvýšen v mESC ošetřeném TCS. V experimentech se zebrafish, po 24 hpf léčby, se kontroly vyvinuly do pozdního stádia somitogeneze, zatímco embrya vystavená 300 μg/L TCS byla stále v rané fázi somitogeneze a tři geny (4. října, Sox2 a Nanog) byly upregulovány v ošetřených skupinách ve srovnání s kontrolami. Tyto dva modely prokázaly, že TCS může ovlivnit raný embryonální vývoj narušením exprese pluripotenčních markerů (4. října, Sox2 a Nanog).

Toto je náhled obsahu předplatného, ​​přístup prostřednictvím vaší instituce.


PŘÍSTUP K DATŮM

Data byla odeslána do NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) pod přístupovým číslem GSE56893.

Autoři děkují B. Jostovi, C. Keimemu a členům sekvenční platformy IGBMC (Štrasburk, Francie) za přípravu knihovny sekvenování ChIP a sekvenování Solexa J. Lachuera, F. Barbeta a členům platformy sekvencování ProfileXpert ( Lyon, Francie) za sekvenování knihoven RNA-seq a J. Moore (Fluidigm Corporation, South San Francisco, Kalifornie 94080, USA) za technickou pomoc s validací genů DE RT-qPCR. Rádi bychom také poděkovali I. Masseovi za vytvoření protokolu RIP a RXR ChIP a M. Parisovi, B. Boussauovi, O. Gandrillonovi, S. Gonin-Giraudovi, F. Flamantovi za kritické čtení rukopisu a plodné diskuse. Tato práce byla provedena pomocí výpočetního zařízení CC LBBE/PRABI.


Xenopatients 2.0

Ve sci-fi thrilleru Menšinová zpráva, specializované policejní oddělení s názvem “PreCrime ” zatýká zločince identifikované předem na základě předvídavosti poskytnuté 3 geneticky pozměněnými lidmi s názvem “PreCogs ”. Navrhujeme, aby technologii kmenových buněk Yamanaka bylo možné podobně použít k (epi) genetickému přeprogramování nádorových buněk získaných přímo od pacientů s rakovinou a vytvořit samostatně se vyvíjející personalizované translační platformy k předvídání evoluční trajektorie jednotlivých nádorů. Tato strategie přináší velkou populaci kmenových buněk a zachycuje genom rakoviny postiženého jedince, tj. PreCogem indukované pluripotentní kmenové (iPS) rakovinné buňky, které jsou okamžitě k dispozici pro experimentální manipulaci, včetně farmakologického screeningu pro personalizované “stemotoxické ” protinádorové léky. Rakovinové buňky PreCog-iPS se po ortotopické injekci do odpovídajících cílových tkání imunodeficientních myší (tj. Myší avatary PreCrime-iPS) znovu diferencují a tento model in vivo proběhne specifickými rakovinnými stádii, aby přímo prozkoumal jejich biologické vlastnosti pro screening léků, diagnostika a individuální léčba u jednotlivých pacientů. PreCog/Přístup PreCrime-iPS může provádět sady srovnání pro přímé pozorování změn v buněčné linii rakoviny-iPS vs. normální buněčná linie iPS odvozená ze stejného lidského genetického pozadí. Úpravy genomu buněk PreCog-iPS by mohly vytvořit translační platformy pro přímé zkoumání vazby mezi změnami genomové exprese a buněčnou malignizací, která je do značné míry prostá genetického a epigenetického šumu, a poskytnout důkaz o principu pro špičkové 𠇌hromozomální terapie ” zaměřené proti aneuploidii rakoviny. Můžeme odvodit epigenetické značky, které korigují tumorigenní povahu přeprogramované populace rakovinných buněk a normalizují maligní fenotyp in vivo. Geneticky upravené modely podmíněně přeprogramovatelných myší k přechodnému vyjádření faktorů kmenovosti Yamanaka po aktivaci fenotypových kopií konkrétních rakovinných onemocnění by mohly zásadně vyhodnotit “reprogramovací léčbu ” pro rakovinu. Nová éra xenopatientů 2.0 generovaná pomocí jaderného přeprogramování epigenetických krajin genomů rakoviny odvozených od pacientů může znamenat revoluci v současných personalizovaných translačních platformách ve výzkumu rakoviny.

Ve Steven Spielberg ’s 2002 neo-noir sci-fi thriller filmu Menšinová zprávaSpecializované policejní oddělení s názvem PreCrime zadržuje zločince na základě předvídavosti poskytované 3 geneticky pozměněnými lidmi zvanými PreCogs. Tři PreCogové mají vizi a jména oběti a pachatele, videozáznamy zločinu a přesný čas jejich výskytu jsou poskytnuty elitní skupině pro vymáhání práva, PreCrime, které jsou odeslány k zatčení předpokládaného vraha a zabránění zločin. Systém je úspěšný, ve městě po uvedení systému do provozu nedochází k žádným vraždám. Pokud bychom mohli podobně navrhnout nejmodernější nástroje k předpovědi vzhledu biologických vlastností a buněčných vlastností, které nejsou patrné v klinicky detekovatelných stádiích, mohli bychom použít vzorky rakoviny, které jsou izolované pro hodnocení prognostických a prediktivních biomarkerů, abychom viděli do budoucnosti jednotlivých nádorů molekulárně předjímat a terapeuticky předcházet jejich nežádoucí aktivitě zabíjení. The Menšinová zpráva ’Testuje se software podobný PreCog k předpovídání zločinů a 3D obrazovky představované ve fiktivním světě se staly realitou. Naše současná schopnost předvídat evoluční trajektorii jakékoli jednotlivé rakoviny bohužel zůstává v plenkách.

Navrhujeme, aby běžně zapomenuté ocenění Bonda a spol. 1 před více než deseti lety, že �iferenciace doprovázející maligní progresi rakoviny může hrát příčinnou spíše než pasivní roli při přechodu kritického chování nádoru z dobře diferencované na vysoce agresivní formu ” musí být přehodnocena ve světle Nobelovy ceny za rok 2012 Cena Yamanaka ’s indukovaná technologie pluripotentních kmenových (iPS) buněk, 2, 3, která poskytla chybějící důkaz, že většina, ne -li všechny, somatické savčí buňky mají dediferenciační potenciál. Přeprogramování rakovinných buněk získaných přímo z primárních nádorů u jednotlivých pacientů může vytvořit vývojová okna živých buněk, která by mohla fungovat jako nové, samostatně se vyvíjející personalizované modely rakovinového onemocnění. Personalizované translační platformy pro předvídání evoluční trajektorie jednotlivých nádorů lze generovat pomocí in vitro generovaných buněk PreCog-iPS přímo přeprogramovaných z nádorových buněk odvozených od pacienta a jejich in vivo derivátů PreCrime-myší avatar získaných u imunodeficientních myší po ortotopické injekci PreCog- iPS na stejném místě, kde byl vytvořen primární nádor.

Pochopení rakoviny jako nemoci přeprogramování a diferenciace

Pro vysvětlení fenotypové a funkční heterogenity v lidských nádorech se objevily dva převládající modely. 4 Takzvaný “stochastic ” nebo 𠇌lonal evolution ” model je založen na klasických teoriích výběru mutantů, kteří jsou schopni přežít v konkrétních prostředích. Stochastické mutace ve vhodném buněčném typu jsou vybrány, pokud mají buňky výhodu přežití nebo proliferace. Tato vybraná buňka následně roste a následující mutace u potomků poskytují nádor s četnými mutacemi. Pouze některé mutace jsou však vybrány pro výhody, které poskytují (𠇍rivers ”), ostatní mutace jsou “passengers ”. Heterogenita nádoru v tomto modelu závisí na konstelaci mutací a fenotypů, které podle toho generují. Analýzy hloubkového sekvenování odhalily, že různé typy nádorů se významně liší z hlediska jejich mutační zátěže a existence více klonů v každé nádorové hmotě. 5 - 7 Druhý model je z velké části založen na principech biologie kmenových buněk. 8 - 10 Karcinogeneze zahrnuje akumulaci četných mutagenních událostí po dlouhou dobu, ale pouze normální kmenové buňky s vrozenou schopností sebeobnovy mohou zůstat ve tkáni dostatečně dlouhou dobu, aby akumulovaly onkogenní změny, které jsou nezbytné pro podporu úplné transformace . Kmenové buňky pro dospělé mohou představovat buňky původu v nádorech, které pocházejí z tkání s vysokým epiteliálním obratem, protože mohou být přímo zaměřeny na iniciační události rakovinných kmenových buněk (CSC) (tj. CSC přímo vyplývají z maligní transformace dospělých kmenových buněk) . Více oddaní progenitorové mohou získat mutace a/nebo epigenetické změny, které udělují ektopickou kapacitu pro neustálou sebeobnovu CSC. Všechny rakovinné buňky v nádoru pocházejí ze speciálních samoobnovujících se CSC v tomto tradičním pohledu na jednosměrnou hierarchii CSC, a v důsledku toho buněčná heterogenita vyplývá z CSC podstupujícího aberantní diferenciaci za vzniku patologicky rozpoznané dezorganizované hmoty. Nádory jsou aberací mechanismů poháněných kmenovými buňkami, které řídí normální vývoj odpovídající tkáně. Některé tumory obsahují směsi velmi nezralých buněk smíchaných s více diferencovanými buňkami se subpopulací buněk nesoucích takzvané 𠇌SC markery ”, které mohou regenerovat celé tumory v xenograftech (tj. Buňkách iniciujících nádor) s buněčnou heterogenitou původní hmotnosti. 8-13

CSC zjevně vykazují vlastnosti podobné kmenovým buňkám, ale tyto buňky nemusí nutně pocházet z přímé transformace kmenových buněk normální tkáně nebo progenitorových buněk. Vytvářejí se také CSC a ne pouze zrozené jednotlivé nádory obecně obsahují několik fenotypicky nebo geneticky odlišných CSC, protože diferencované normální nebo jiné než kmenové buňky získávají buněčné vlastnosti CSC aktivací částečně známých cest ke kmenům. 14 - 23 “stemness ” je kriticky spíše vznikající dynamický stav než přímý důsledek aktivity konkrétního genu pro kmen nebo souboru genů pro kmen. Buněčný stav CSC se neustále vyvíjí a lze jej zapnout nebo vypnout v reakci na podněty vnitřní nebo mikroprostředí buňky, včetně terapeutik. Navíc podmnožina CSC může být výhradně zodpovědná za metastatické šíření, což je konečný krok v 90% všech smrtelných solidních nádorů. Není-li počáteční genetický defekt ve víceúčinných kmenových buňkách jediným mechanismem pro generování dynamicky se vyvíjejících rezervoárů CSC, pak primární CSC nejsou nutně totožné s metastatickými CSC. V tomto scénáři přesnější popis komplexních událostí, ke kterým dochází během progrese nádoru, vyžaduje začlenění potenciálu pro �lulární přeprogramování ” se stochastickými a CSC modely. 24 - 30 Rakovina, buněčná plasticita a přeprogramování buněčného osudu jsou vysoce provázané procesy s ohledem na to, že ne všechny rakovinné buňky mají nezbytnou schopnost umožnit jejich přeprogramování do CSC �lulárních stavů ”, a pouze některé rakovinné geny (např. Přeprogramování faktorů kmenovosti ) mají požadovanou schopnost plně vyvolat proces přeprogramování ve správném časoprostorovém kontextu. Tento nový kompozitní model získávání stavu kmenových buněk předpokládá rakovinu jako onemocnění, které primárně zahrnuje buněčnou diferenciaci a ve kterém je mnoho hnacích sil tumorigenního procesu, včetně ztráty klíčových nádorových supresorů, jako jsou aberantní transkripční faktory, signální kaskády nebo epigenetické regulátory, hrají permisivní roli v nádorové progresi tím, že zmírňují vývojově nepříznivý proces získávání schopností iniciovat nádor a/nebo metastázy. Běžně pozorovaná funkční inaktivace p53, která je zvláště koncentrovaná v nádorech vykazujících plasticitu a ztrátu diferenciačních charakteristik, je obecně přisuzována výhodám přežití v důsledku snížené apoptotické buněčné smrti, zastavení buněčného cyklu a rozšířených příležitostí pro vývoj rakovinotvorných buněk poskytovaných genomickou nestabilitou . Stále rostoucí důkazy podporují hypotézu, že inaktivace p53 může destabilizovat diferencovaný stav a umožnit návrat do buněčného stavu podobnějšího kmeni za přítomnosti příslušných onkogenních lézí. 20, 31 - 34

Pokud je rakovina vnímána jako choroba přeprogramování a diferenciace, buňky s vlastnostmi podobnými kmenům by mohly být generovány kdykoli během progrese rakoviny, pokud jsou potlačeny nádorové supresory, jako je p53 (nebo jiné faktory s funkcí p53), a jsou přítomny vhodné onkogenní léze, které mohou umožnit epigenetické přeprogramování do kmenového buněčného stavu. Potenciál plasticity non-CSC k získání CSC buněčného stavu v závislosti na jejich (epi) genetickém stavu a/nebo interpretaci mikroprostředí v nepřítomnosti nebo přítomnosti stresu (např. Hypoxie, deprivace glukózy a chemoterapie) není uvažován v konvenční zobrazení hierarchie kmenových/progenitorových buněk v normální tkáni se transformuje do podobné jednosměrné hierarchie CSC a tento koncept mění naše současné vnímání biologie CSC (obr. ਁ). Tumorigeneze může být zahájena a udržována přeprogramováním kmenových buněk, což je molekulární proces, kterým genetické změny rakoviny resetují epigenetický a transkripční stav původně zdravé buňky (tj. Rakovinné buňky původu) a stanoví nově získaný, patologický diferenciační program aberantní stonky, která nakonec vede k rozvoji rakoviny. Navíc diferencované rakovinné buňky mohou dynamicky měnit své transkripční a epigenetické obvody, aby se zapojily do kmenových buněk a podporovaly růst rakoviny aktivací ovladačů specifických transkripčních faktorů a modulací některých spolupracujících regulátorů chromatinu.Tyto dynamické obousměrné přechody by mohly poskytnout sjednocující pohled na buněčnou organizaci uvnitř nádorů, protože stejná síť klíčových regulátorů, které přispívají k transformaci a přechodům buněčného stavu k vytvoření epigenetické hierarchie ve vzácných populacích CSC, vede k diferencovanějšímu buněčnému potomstvu (tj. onkogenní přeprogramování), které mohou také působit v rámci zavedeného nádoru k přesměrování diferencovaných nádorových buněk do méně diferencovaného a kmenově podobnému buněčnému stavu a nastolit dynamickou rovnováhu mezi přeprogramováním a diferenciací. 30 Několik nezávisle odvozených a molekulárně odlišných kmenových klonů by se mohlo vyvinout v závislosti na pravděpodobnosti přeprogramování v nádorech. Některé geneticky a epigeneticky nestabilní soubory CSC mohou iniciovat nebo pokračovat v klonálním růstu v závislosti na úrovni a povaze onkogenních stimulů a v reakci na odlišná místní mikroprostředí. Jiné CSC mohou zůstat nečinné, dokud nebudou přijaty příslušné signály, například aberantní mikroprostředí vytvořená v nádorech, která mohou ovlivnit typ CSC, které vznikají ze souvisejících, ale geneticky odlišných a nezávisle se množících klonů rakovinotvorných buněk. Tento složitý scénář by mohl vysvětlit výskyt více klonálních linií v nádorech, které byly identifikovány pomocí jednobuněčného sekvenování. 7 Výsledná heterogenita se může projevovat jako různé stavy CSC, které se liší z hlediska jejich proliferačního, biomarkerového a chemosenzitivního profilu. 35

Obrázek ਁ. Rakovina je choroba přeprogramování a diferenciace. Nedávné nálezy z více laboratoří ukázaly, že normální buňky a velká populace nádorových buněk, které vykazují nízkou schopnost sebeobnovy a vyšší pravděpodobnost terminální diferenciace, mají schopnost dediferencovat a získat stonek podobný rakovině (samoobnovující, multipotentní, buněčný stav s vysokým množením nádoru a chemo/radio-rezistentní) v reakci na genetickou manipulaci nebo narážky prostředí. Normální buňky a diferencované rakovinné buňky mohou získat kmenové buněčné stavy několika induktory dediferenciačních mechanismů, včetně transkripčních sítí zahrnujících klíčové transkripční faktory (např. Oct4, Sox2, Nanog), miRNA (např. Rodina let-7, miR-200) , mikroprostřední signály (např. hypoxie, zánět, autokrinní/parakrinní onkogenní signální dráhy), epigenetické modifikace (např. demetylace DNA, acetylace/methylace histonu) a metabolické přeprogramování. Tato zjištění z rozmanité řady experimentálních modelů spolu s korelačními klinickými údaji silně podporují skutečnost, že kmen rakoviny je spíše dynamickým stavem, než přímým důsledkem aktivity konkrétního genu pro kmen nebo souboru genů pro kmen v rakovinných tkáních. Na takzvané CSC je třeba pohlížet jako na několik evolučně vybraných rakovinotvorných buněk s nejkonkurenceschopnějšími vlastnostmi v určitém čase (např. Nesmrtelnost, spánek, chemická nebo radiorezistence, motilita atd.) Reverzibilně udržované (epi) genetickými mechanismy, které jsou výsledkem spíše stochastického než deterministického procesu. 89 - 92

Je pozoruhodné, že model přeprogramování a diferenciace vzniku a evoluce rakoviny vysvětluje mnoho zjevně paradoxních aspektů biologie nádorů: (1) obtížnost sladění vzácnosti (čísel CSC) s robustností (vlastností CSC) u některých nádorů ( 2) obtížnost aplikace hierarchických modelů na některé nádory, jako je například metastatický melanom, což je jeden z nejagresivnějších lidských karcinomů odolných vůči léčbě, který se neřídí hierarchií CSC 36 a pravděpodobně představuje extrémní příklad, v němž určité genetické make-upy umožňují snadnou konverzi mezi státy bez CSC a CSC, aby téměř celá populace nádorových buněk byla vybavena vlastnostmi CSC (3) nedostatek CSC markerů, které by umožňovaly obecnou identifikaci kmenové struktury v daném nádoru a obrovskou plasticitu mnoha domnělé CSC 37 - 39, společný molekulárně genetický program pro CSC zůstal do značné míry nepolapitelný i v rámci stejného typu karcinomu a menšího počtu chromozomů V diseminovaných CSC jsou pozorovány aberace, které se vyskytují v dřívějších stádiích vývoje nádoru, než se dříve myslelo, a (4) výskyt unikátních stavů podobných kmenům v důsledku kontinuální evoluce a přizpůsobování se novým omezením, jako jsou mikroprostřední stresy nebo terapeutika, která může vysvětlovat schopnost některých nádorových buněk transdiferencovat se na funkční vaskulární 𠄾ndoteliální buňky, které odolávají antiangiogenní terapii, 40 vykazují pozoruhodnou plasticitu v chemorezistenci (tj. jednotlivé buňky mohou přechodně předpokládat reverzibilní stav tolerantní k lékům, který chrání populaci před eradikací v důsledku potenciálně smrtící expozice), 41 a migrují a metastázují v reakci na dynamické interakce mezi epiteliálními, samoobnovovacími a mezenchymálními genovými programy, které určují plasticitu epiteliálních CSC. Molekulární heterogenita a stochasticita genové exprese může pohánět kontinuum stavů rakovinotvorných buněk, které exprimují kmenové buňky a geny specifické pro linii, aby se podpořila větší pravděpodobnost vstupu do stavu podobného CSC, který může kontraintuitivně nastat v reakci na rovnováhu mezi diferenciačními potenciály . 42 - 44

Technologie kmenových buněk Yamanaka pro obnovu nebo předvídání evoluční trajektorie jednotlivých druhů rakoviny

Buňky PreCog-iPS a avatary myší PreCrime

Klíčovým důsledkem výše uvedeného modelu přeprogramování – rozlišení při tvorbě a vývoji rakoviny je to, že diferencované somatické (nerakovinové a rakovinné) buňky jsou dostatečně plastické, aby aberantně přeprogramovaly a získaly vlastnosti CSC. Přeprogramování související s nádorem proto může stačit ke generování aberantních, ale robustních kmenových buněčných stavů. Bond a kol. průkopnicky navrhl, že zjevná diferenciace doprovázející maligní progresi hraje v chování nádoru spíše příčinnou než pasivní roli. 1 Od té doby však většina výzkumníků rakoviny přijala alternativní pohled, ve kterém nádory dodržují v podstatě nevratné hierarchie buněčné diferenciace paralelně s normálními tkáněmi. Kromě toho existuje jen málo přesvědčivých experimentálních důkazů na přímou podporu potenciálu buněčné dediferenciace v savčích buňkách. Takahashi a Yamanaka však prokázali, že nucené vyjádření 4 transkripčních faktorů, konkrétně 4. října, Sox2, Klf4, a c-Myc, indukovali myší fibroblasty, aby přijaly pluripotentní buněčné osudy, které se podobaly kmenovým buňkám. 2, 3 Tyto a následné studie prokázaly, že prakticky všechny typy buněk mohou generovat indukované pluripotentní kmenové buňky (iPS), když jsou použity příslušné sady genů pro přeprogramování, což podporuje hypotézu, že většina, ne -li všechny, somatické savčí buňky mají dediferenciační potenciál a potvrzuje inherentní reverzibilita kroků buněčné diferenciace. Skutečnost, že několik přeprogramovacích transkripčních faktorů představuje bona fide onkogeny, zatímco mnoho genů, které působí jako bariéry jaderného přeprogramování, odpovídá známým nádorovým supresorům (např. P53), 45–50, silně naznačuje, že nezbytné epigenetické přepojení pro buněčné přeprogramování může být částečně rekapitulováno během buněčné transformace. V souladu s tím použití podpisu exprese buněk iPS složeného z genů, které jsou důsledně upregulovány v nezávislých studiích s kulturami iPS, odhalilo významné podobnosti mezi rakovinami s mutací p53 a buňkami, které prošly záměrným přeprogramováním in vivo. 51 - 55 Frekvence přeprogramování se zdála být extrémně nízká. Výskyt buněčných bariér proti indukovanému přeprogramování podporuje proveditelnost resetování epigenetické architektury jakékoli diferencované buňky tak, aby se podobala kmenové buňce, možná ne dokonale, protože přeprogramování p53 související s nádorem -neficientní, buňky exprimující onkogen mohou generovat aberantní kmenové buněčné stavy, které fenoskopují fetální kmenové buňky nebo buňky iPS.

CSC pravděpodobně nevznikne podle „zcela nové biologie“ v molekulárním scénáři, ve kterém je přeprogramování buněk přirozeným, vysoce plastickým fenoménem, ​​který umožňuje, aby se kmenovost objevila a diverzifikovala v tumorigenním kontextu. Mechanismy generování a evoluce CSC proto nejsou plně přístupné analýze pomocí běžně používaných vzorků pacientů, protože tyto nádory lze studovat až poté, co došlo k transformačním událostem. Navíc reverzibilní a přechodné modifikace, spíše než akumulace nevratných a stabilních modifikací, primárně regulují klíčové události, které řídí získávání CSC podobných buněčných stavů. Vzhled biologických vlastností a buněčných vlastností není u klinicky detekovatelných nádorů zřejmý a vzorky rakoviny, které jsou izolovány pro rutinní hodnocení prognostických a prediktivních biomarkerů, představují významné výzvy. Disagregace nádorové hmoty pro analýzy může zakrýt původně přítomnou lokální heterogenitu a geneze stavů rakovinotvorných buněk podobných kmenům pravděpodobně odráží poškození reaktivovaného normálního repertoáru kmenových buněk. Jsme nuceni prozkoumat spektrum stavů normálních i neoplastických kmenových buněk při vývoji nových strategií, které se zaměřují na plasticitu a přeprogramování rakovinných buněk, a nikoli na vybrané markery v buňkách podobných CSC. Můžeme však manipulovat s událostmi přeprogramování v nádorových tkáních, abychom vytvořili samorozvojová vývojová okna nádorových onemocnění a obnovili minulé události v rychle rostoucích typech lidských nádorů? Mohou být rakovinné buňky odvozené od pacienta geneticky upraveny způsobem, který nás může předem informovat o budoucnosti jednotlivých nádorů, aby bylo možné molekulárně předvídat a terapeuticky zabránit jejich nežádoucí aktivitě zabíjení, jako v případě Menšinová zpráva?

Translační výzkum s pacientskými buňkami a ortotopickými modely je nejnovějším přístupem k výzkumu translační rakoviny blíže k lůžku. Vytvoření a charakterizace sériově transplantovatelných, ortotopických, od subjektu odvozených nádorových štěpů, které si zachovávají klíčové vlastnosti původního primárního vzorku tumoru a účinně reprodukují vzorce rezistence vůči lékům a/nebo šíření, které jsou charakteristické pro specifické nádory při diagnostice, jsou užitečné zdroje pro výběr. vhodnějších léčebných režimů a vývoje nových lékových terapií a nových terapeutických aplikací pro v současnosti schválená léčiva. 56 - 64 Hodnocení terapeutických odpovědí v modelech ortotopických nádorů odvozených od pacienta, které udržují morfologické, histologické a genetické charakteristiky nádorů pacientů, včetně chování stromální složky a tkáňové architektury, by zlepšilo preklinický translaci léčiva k pacientům. Účinnost, rychlost a náklady však omezují použití tohoto typu diagnostického modelu in vivo myšího avatara. Proces vývoje vyžaduje velké množství čerstvého nádorového materiálu a intenzivní zdroje ke generování nádorového štěpu. I za nejlepších podmínek 25 �% implantátů selže a ty, které štěpují, vyžadují 6 𠄸 mo další propagace, aby byly pro léčbu užitečné. Omezení tohoto přístupu jistě zpochybňují širokou klinickou aplikaci procesu, ale některá slibná data odezvy naznačují, že tyto “mouse avatary ” jsou zajímavým výzkumným nástrojem, který se může stát užitečným v kombinaci s genomovou revolucí. Obrovské zdroje věnované sekvenování genomů lidských nádorů však vytvořily důležité soubory dat pro komunitu biologie rakoviny, ale bylo odhaleno jen málo nové biologie. 65 Sekvenování příští generace (NGS) nádorů pacientů před a po chemoterapii spojené s růstem nádorových buněk pacienta na myších za účelem testování predikcí řízených technikou NGS může dále komplikovat jakýkoli pokus o převedení hromadných genetických dat do možností terapeutické léčby jednoduchým, přímočarým způsobem. Farmakogenomické studie, jako je studie provázené terapie genomu rakoviny prsu (projekt BEAUTY), ve které vědci získají 3 sekvence celého genomu (jednu ze zdravých buněk pacienta před léčbou, jeden genom tumoru před chemoterapií a jeden genom tumoru po chemoterapii ) a spárovat pacienty s myšími avatary, aby identifikovali nejlepší individuální léčbu, objasní, zda lze chemoterapii přizpůsobit pacientům s rakovinou na základě jejich individuálních a nádorových genomů. Tato kombinace technik by proto měla zlepšit naše chápání biologie rakoviny, protože rekapitulace heterogenity celého nádoru v buňkách odvozených od pacienta umožňuje hodnocení orgánově specifické citlivosti na léčivo a mechanická vysvětlení chemorezistence. Skutečný důkaz koncepce bude pocházet z kandidátů léčiv, kteří jsou efektivní v modelech xenoštěpů buněk odvozených od pacienta, které lze snadno převést do klinických aplikací. Primární model nádoru odvozeného od pacienta je slibný pro personalizovaný objev léčiv v celém genomu a racionálnější modelování klinických studií, ale translační platformy myší a avatarů náročné na čas a zdroje budou omezeny na špičkové výzkumné laboratoře. Navrhujeme, aby technologie kmenových buněk Yamanaka mohla být použita k (epi) genetickému přeprogramování primárních rakovinných buněk získaných přímo od jednotlivých pacientů k vytvoření samo-vyvíjejících se vývojových oken rakovinového onemocnění.

PreCog-iPS rakovinné buňky

Generace a nástroje

Předpokládáme, že jaderné přeprogramování nádorových buněk odvozených od pacienta může poskytnout velkou populaci podobnou CSC, tj. PreCog-Rakovinové buňky iPS, které by teoreticky mohly být množeny neomezeně dlouho v pluripotentním stavu nebo téměř pluripotentním stavu. V příliš zjednodušeném, hypotetickém přístupu budou vzorky rakoviny získány bezprostředně po resekci a jako kontroly budou použity histologicky normální tkáně na okrajích vzorků (obr. ਂ). Epiteliální buňky budou izolovány a rakovinné a normální okrajové buňky budou infikovány viry kódujícími faktory kmenovosti Yamanaka. Genomická DNA bude izolována z okrajů vzorku a epiteliálních buněk rakoviny, které byly kultivovány odděleně. Rakovinové buňky PreCog-iPS, které zachytily genom postiženého jedince, by mohly být generovány pomocí přeprogramování nádorových epiteliálních buněk a zjevně normálních, izogenních buněk za okraji nádoru. Tyto buňky budou okamžitě k dispozici pro experimentální manipulaci, včetně přípravy rakovinných vakcín, farmakologických screeningů zaměřených na objevení protilátek proti pluripotentním rakovinotvorným buňkám a zkoumání jejich vývojového potenciálu. Může být například zaveden vysoce výkonný screening pro identifikaci cytotoxických inhibitorů rakovinných buněk PreCog-iPS. Vývoj a optimalizace protokolu, který umožní kultivaci nediferencovaných rakovinotvorných buněk PreCog-iPS ve vícejamkové destičce s vysokým obsahem, umožní automatickou aplikaci více (známých nebo experimentálních) protirakovinných sloučenin a přesné hodnocení buněk životaschopnost po krátkodobé (např. 24 h) expozici. Inhibitory specifické pro pluripotent lze identifikovat na úrovni jednotlivých pacientů. Mohli bychom prověřit selektivní cytotoxicitu identifikovaných léčiv ve více koncentracích proti diferencovaným buňkám, které jsou geneticky spárovány s nediferencovanými buňkami v předchozím screeningu, abychom získali spolehlivé hodnoty citlivosti. Můžeme také prověřit původní nádorové buňky odvozené od pacienta, ze kterých byly odvozeny linie rakovinných buněčných buněk iPS, aby se vytvořily spolehlivé hodnoty citlivosti pro PreCog-iPS a jejich rakovinné buňky původu. Nastavení velmi přísných prahových hodnot (např. 㺀% inhibice v rakovinných buňkách PreCog-iPS, ale méně než 20% inhibice v jiných typech diferencovaných rakovinných buněk při stejné vysoké koncentraci dané sloučeniny) by nakonec mohlo identifikovat pluripotentní specifickou rakovinu (PluriSCan) léky, tj. bona fide “stemotoxické ” léky proti rakovině. 66 Rakovinové buňky PreCog-iPS by měly ztratit citlivost na PluriSCan-stemotoxické léky po diferenciaci a rakovinné buňky odvozené od pacienta by měly získat tuto citlivost po přeprogramování na buňky iPS. Krátké trvání expozice PluriSCan-stemotoxická léčiva na této obrazovce (24 hodin) a přísný práh pro identifikaci “hit ” (㺀% snížení počtu životaschopných buněk) budou identifikovat cytotoxické sloučeniny, které aktivně eliminují pluripotentní rakovinné buňky spíše než inhibitory proliferace. Můžeme ověřit účinek specifický pro pluripotent PluriSCan-stemotoxická léčiva využívající systémy genetického značení pro expresi genů pluripotentních charakteristických znaků (např. červené značení) vs. rané markery diferenciace (např. zelené značení), protože tato činidla specificky eliminují nediferencované (červené) buňky bez detekovatelného účinku na (zelená) diferencovaná populace. Aplikace toxikogenomických přístupů k identifikaci změn genové exprese po expozici rakovinných buněk PreCog-iPS PluriSCan-stemotoxické léky by mohly poskytnout funkční anotaci deregulovaných genů a identifikovat klíčové cesty, které jsou kauzálně narušeny cytotoxickými účinky PluriSCan-stemotoxické léky. Baterii neznámých sloučenin s předpokládanou protirakovinnou aktivitou lze testovat aplikací údajů o genové expresi na mapu konektivity (cmap), což je databáze údajů o transkripční expresi v celém genomu generovaných z kultivovaných lidských buněk ošetřených bioaktivními malými molekulami. Tento proces může usnadnit objev cest, které jsou narušeny malými molekulami neznámé aktivity na základě změn společné genové exprese, které podobné malé molekuly způsobují. Důležité je, že screening a objevování “hits ” může být velmi cenné při hledání personalizovaných kandidátů na léky s anti-CSC aktivitou, i když PreCog odvozený od pacienta-iPS rakovinné buňky dosáhnou téměř pluripotentního stavu, který se rychle odvozuje od zhoršené a nerovnovážné časné diferenciace rakovinotvorných buněk.

Obrázek ਂ. Nukleární přeprogramování rakovinotvorných buněk odvozených od pacienta: Generace a nástroje. Schematický výkres znázorňující generování a využití pacientských rakovinných buněk PreCog-iPS a ortotopických nádorů PreCrime-iPS.

Vznik technologie úpravy genomu v posledních několika letech umožnil generovat a zkoumat modely lidských buněčných chorob rychleji a efektivněji. Rozsah, v jakém rakovinné buňky iPS odvozené od pacienta nabídnou jakoukoli výhodu v našem chápání chorobného procesu, se může zdát nejasné u onemocnění, které je způsobeno mnoha genetickými a environmentálními faktory, jako je rakovina. Měli bychom uznat, že nejpřísnější možná srovnání by nastala mezi buněčnými liniemi, které se liší pouze mutacemi onemocnění, tj. Jinak izogenními buněčnými liniemi. Oprava specifických genetických změn v genomech rakovinných buněk PreCog-iPS by vyšetřovatelům umožnila přímo propojit genotyp s fenotypem a stanovit kauzalitu (např. Funkční studie k ověření nových kandidátů genů rakoviny) v pozadí pluripotentního rakoviny a během samo-vyvíjející se diferencované státy.Výsledky mohou porovnat relevantní fenotypy (např. Citlivost na molekulárně cílené léky) a do značné míry minimalizovat zmatky, aby bylo možné vyvodit vědecky přísnější závěry. Jakékoli mimo cíle, které produkují nástroje pro úpravu genomu, mohou způsobit, že je nereálné očekávat 100% izogenní rodičovské a cílené buněčné linie v daném experimentu. Tento faktor však nenarušuje skutečnost, že genomové inženýrství buněk iPS odvozených od rakovinotvorných buněk odvozených od pacienta a izogenních buněk iPS odvozených od zjevně normálních, izogenních buněk přesahujících okraje nádoru se může stát strategií typu proof-of-princip a poskytnout nepředvídatelné vhled do patofyziologie rakovinotvorných chorob řízené kmenem. Nejrobustnějším možným návrhem studie konceptu konceptu by bylo vložení dobře známých mutací, které jsou běžně nadměrně zastoupeny v některých rakovinných tkáních (např. KRAS u rakoviny slinivky a tlustého střeva, EGFR u karcinomu plic) nebo kandidáti nového ovladače genů rakoviny do buněčné linie iPS, která je přeprogramována buď z netříděných nebo specifických subpopulací (např. dospělých kmenových buněk) v normální tkáni sousedící s rakovinnou tkání. Tato metoda by testovala dostatečnost mutace pro onemocnění, nezbytnost mutace pro chování choroby a/nebo reakci na molekulárně cílené léky a opravila klíčové chorobné mutace v buněčné linii iPS specifické pro pacienta s rakovinou. V současné době existují nástroje pro genomovou editaci v lidských pluripotentních kmenových buňkách, např. Nukleasy zinkových prstů (ZFN), efektorové nukleázy podobné transkripčnímu aktivátoru (TALEN) a klastrované pravidelně interspaced shored palindromic repeats (CRISPRs)/CRISPR-associated (Cas) systems, 67–71 by mohly provádět cvičení na principu důkazu, aby jednoznačně objasnili nezbytnost a dostatečnost daných mutací pro dané fenotypy rakovinového onemocnění. Tento přístup může být velmi cenný pro posouzení důležitosti genetických modifikátorů pro penetraci rakovinotvorných onemocnění, tj. Zda rakovinná mutace vyvolává v některých buněčných liniích fenotyp onemocnění, ale v jiných ne. Obzvláště informativní může být začátek písmenem a BRCA1-mutovaná buněčná linie iPS specifická pro pacienta s rakovinou prsu a použití editace genomu k 𠇌 ” BRCA1 mutace nemoci.

Korekce ” maligního fenotypu v kultuře s použitím buněk PreCog-iPS v krátkodobém horizontu může významně urychlit studium buněčné patologie a modelování chorob a usnadnit translační výzkum terapeutik. Nástroje pro editaci genomu by měly vytvořit přímočarý přístup k vložení reportérů do požadovaných genomových lokusů rakoviny, aby bylo umožněno RNA interferenční nebo screening malých molekul k identifikaci genů a sond, které poskytují požadovaný funkční efekt. Dlouhodobé používání úpravy genomu může vytvořit 𠇌hromozomové terapie ”, které využívají epigenetické strategie k regulaci chromozomů, protože rakovinné buňky PreCog-iPS budou obsahovat odpovídající aberantní karyotyp nebo počáteční nádorovou populaci odvozenou od pacienta. Nádorové buňky často vykazují abnormální počet chromozomů, což je jev známý jako aneuploidie, a nerakovinná aneuploidie generuje abnormální fenotypy u všech testovaných druhů (např. Trizomie 21 generuje Downův syndrom). Aneuploidie specifické pro rakovinu generují komplexní, maligní fenotypy prostřednictvím abnormálních dávek tisíců genů. Aneuploidie může částečně vysvětlit 2 vlastnosti buněk souvisejících s CSC, jako je nesmrtelnost, protože rakovina přežívá negativní mutace a cytotoxická léčiva prostřednictvím rezistentních poddruhů díky své buněčné heterogenitě a neselektivních fenotypů, jako jsou metastázy, kvůli vazbě na stejné selektivní fenotypy chromozomy. 72 - 78 Strukturálním chromozomovým přestavbám byla věnována značná pozornost, ale úloha aneuploidie celého chromozomu při rakovině je méně chápána. Tato diskuse zastínila úsilí o řešení související, ale neméně důležité otázky: může být aneuploidie zaměřena na léčbu rakoviny? Jiang a kol. 79 nedávno uvedlo, že vložení velké, indukovatelné X-inaktivace (XIST) transgen do DYRK1A lokus na chromozomu 21 u Downova syndromu pluripotentní kmenové buňky využívající ZFN de facto korigovanou nerovnováhu genu na extra chromozomu. Nástroje pro úpravu genomu, které korigují aneuploidní karyotyp, se mohou stát terapií rakoviny, protože tyto nástroje mohou být účinné proti celé řadě nádorů aneuploidie bez předchozí znalosti základních mutací nebo deregulovaných cest.

PreCrime-iPS myší avatary

Generace a nástroje

Buňky PreCog-iPS mohou být cenné při navrhování nových přístupů pro modelování rakovinných onemocnění, protože postupy vedoucí k jejich generování mohou být vysoce kontrolovaným způsobem opakovány za účelem generování velkého počtu buněk pro studie in vitro a in vivo. Kromě toho by obrácení rakovinotvorných buněk odvozených od pacienta z daného evolučního stádia prostřednictvím přeprogramování s faktory kmenovosti Yamanaka mělo umožnit rediferenciaci v testech ortotopické injekce v cílových tkáních imunodeficientních myší, tj. Avatarů myší PreCrime-iPS. Podskupina těchto buněk by podstoupila několik vývojových stádií lidské rakoviny (obr. ਂ). PreCrime-Model myší avatarů iPS by měl procházet specifickými stádii lidských rakovinných onemocnění, na rozdíl od zkoumání charakteristik progrese rakoviny na zvířecím modelu a hodnocení použitelnosti u člověka. Za prvé, přeprogramování rakovinotvorných buněk z rekurentních, pozdních stádií lidských karcinomů na pluripotentní stav by mělo vytvořit opětovné objevení buněčných rysů a molekulárních markerů časných a mezilehlých stádií této konkrétní rakoviny, které již nejsou patrné v terminálních stádiích, z nichž PreCog/Vznikly modely PreCrime-iPS. Rekapitulace raných stádií biologicky agresivních typů lidských karcinomů (např. Rakoviny slinivky, glioblastomu, rakoviny vaječníků a rakoviny plic) vytváří neprobádaná vývojová okna rakoviny, která mohou umožnit přímé prozkoumání jejich biologických vlastností pro screening léků, diagnostiku a personalizovaná léčba. Srovnání s původním nádorem jednotlivého pacienta s krátkodobými histologickými a genomickými profily nás může informovat o schopnosti buněk PreCrime-iPS diferencovat se do lézí spojených s dřívějšími stádii pokročilého onemocnění. Podobně nás dlouhodobé histologické a genomické profily mohou informovat o schopnosti raných stádií buněk PreCrime-iPS diferencovat se na léze, které uspěly jako invazivní stádia onemocnění in vivo. Tyto profily poskytují úplnou rekapitulaci procesu karcinogeneze, který je plně řízen genomem postiženého jedince a zachycen během procesu generování buněk PreCog-iPS.

Mohlo by být zajímavé zkoumat, zda bychom mohli očekávat přepracování rakovinotvorných buněk z raných nebo dokonce předčasných výskytů buněčných rysů a molekulárních markerů v nejranějších, prekurzorových stádiích tohoto konkrétního rakoviny (např. Hyperplastické zvětšené lobulární jednotky u rakoviny prsu) -invazivní stadia rakoviny (např. duktální karcinom in situ lézí při rakovině prsu) do pluripotentního stavu. Bez ohledu na ortotopicky injikovaný osud buněk PreCog-iPS můžeme vytvořit systém, ve kterém mohou být rakovinné struktury, které se vyskytují v nádorech PreCrime-iPS, studovány jako živé, ex vivo nebo in vitro modely prekurzoru, časné, invazivní a metastatické stadia jednotlivých nádorů na úrovni pacienta. Můžeme sbírat tkáně z nádorů PreCrime-iPS s kontralaterální kontrolní tkání v různých intervalech po injekci, abychom stanovili podmínky, za kterých budou tkáně kultivovány in vitro. Tento “organoidní systém ” můžeme použít k rychlé identifikaci biomarkerů a cest, které by mohly umožnit včasnou detekci nebo usnadnit sledování onemocnění po terapii. Mohli bychom například prozkoumat proteiny, které jsou specificky sekretovány nebo uvolňovány z explantátů nádorů PreCrime-iPS, porovnáním s proteiny, které jsou sekretovány nebo uvolňovány z explantátů kontralaterální kontrolní tkáně z rodičovské buněčné linie PreCog-iPS kultivované v nediferencovaném stavu. Bioinformatické přístupy lze použít k objevování dříve nedoceněných sítí a biomarkerů spojených s velmi časnou (i předrakovinovou), časně invazivní nebo metastatickou patologií kombinací dat z xenopatientu 2.0 �r rakoviny #x0201d myší model nemoci a aktuálně dostupné databáze lidských klinických vzorků.

Pokud epigenetické prostředí pluripotence může dominovat nad určitými onkogenními stavy, přesné dekódování molekulárních bariér, které brání převrácení fenotypu rakoviny (diferencovaného) na stav pluripotentní/téměř pluripotentní (kmenový), by nás mohlo informovat o klíčových mechanismech, které řídí jak diferencované rakovinné buňky dynamicky vstupují do kmenových buněčných stavů. Konkrétně, pokud přeprogramování nádorových buněk odvozených od pacienta vede ke ztrátě tumorigenicity, pak by mohlo být možné in vivo normalizovat maligní fenotyp odvozením epigenetických značek, které opravily maligní účinky aktivace onkogenu a inaktivace onkosupresorového genu v přeprogramovaném populace rakovinotvorných buněk. Různé experimentální výsledky naznačují, že rakovinné buňky lze přeprogramovat na nenádorový osud, který ztrácí svou malignitu. Miyoshi a kol. 80 uvedlo, že definované faktory indukovaly přeprogramování rakovinotvorných buněk gastrointestinálního traktu, aby se prokázala pomalá proliferace, senzibilizace na léčbu indukující diferenciaci a snížila in vivo tumorigenezi u myší NOD/SCID. Tito autoři však uváděli pouze tvorbu xenoimplantátů bez histologie nebo imunohistochemie. Zhang a kol. 81 nedávno prokázalo, že přeprogramování buněk sarkomu pomocí 4 kanonických genů Yamanaka plus Nanog a Lin28 vytvořily rakovinné buňky, které ztratily svoji tumorigenicitu, vykazovaly sníženou odolnost vůči lékům a dediferencovaly se jako buňky iPS do různých linií, jako jsou fibroblasty a hematopoetické linie. Je zajímavé, že výraz endogenní c-Myc Zdálo se, že jsou v jejich buněčném modelu redukovány a během procesu přeprogramování byly hypermethylované. Tato zjištění podporují představu, že epigenetická modifikace rakovinné buňky pomocí přeprogramování jader by mohla napravit některé maligní účinky aktivace onkogenu a inaktivace onkosupresorového genu, což může představovat základ pro novou strategii kontroly progrese nádoru. 81, 82 Zhang a kol. 81 popsali terminální diferenciaci a ztrátu tumorigenicity lidských sarkomů pomocí přeprogramování na základě pluripotence, ale tito autoři nedokázali pozorovat benigní zralé tkáňové prvky ve svých testech teratomů. Kim et al., 83 jediná skupina, která hlásila úspěšnou generaci buněčné linie iPS odvozené od pacienta z lidského pankreatického duktálního adenokarcinomu (PDAC), získala pouze jednu linii podobnou iPS z rakoviny slinivky břišní KRAS mutace, převládající hybná síla PDAC, a delece v exonu 2 pivotního supresoru tumoru CDKN2A. Biologické bariéry, jako jsou genetické mutace specifické pro rakovinu, epigenetická remodelace, akumulace poškození DNA nebo buněčná senescence vyvolaná přeprogramováním, mohou ovlivnit přeprogramování lidských primárních rakovinotvorných buněk. 84 Další práce proto určí typy mutací, které předpovídají, zda lze rakovinnou buňku přeprogramovat na pluripotenci. Naopak, geneticky upravené modely podmíněně přeprogramovatelných myší, které přechodně exprimují faktory kmenovosti Yamanaka 85 postupně k aktivaci fenotypových kopií specifických rakovinných onemocnění (např. U transgenních myší BRCA1 nedostatek resp HER2 nadměrná exprese nebo v chemicky indukovaných myších modelech lidských karcinomů) by nás mohla informovat o proveditelnosti “reprogramovací léčby ” rakoviny jako revoluční alternativy k současným terapeutickým přístupům.

Jak bylo uvedeno výše, očekává se, že buňky PreCrime-iPS z jednotlivých nádorů budou mít schopnost postupovat v časných nebo dokonce předrakovinových vývojových stádiích jednoho individuálního rakoviny. Tento přístup by poskytl jedinečnou příležitost pro objev vnitřních procesů a vylučovaných biomarkerů (např. Proteinů, metabolitů) živých, počátečních stádií lidských rakovinných buněk a zejména biologicky agresivních typů lidských karcinomů. Buněčné stavy CSC však již mohou být naprogramovány v pre-maligních rakovinných lézích a tyto buňky iniciující nádor by mohly určit pozdější fenotyp invazivní léze. Rakovinové buňky PreCrime-iPS by proto vyvinuly stádia rakoviny před původním stádiem, ze kterého byly buňky PreCog-iPS zkonstruovány, tj. Bona fide samo-vyvíjející se in vivo modely, které nás mohou předem informovat o budoucnosti jednotlivých nádorů. Schematický přehled integrující klíčové koncepty, které jsou základem relevance �ncer xenopatients 2.0 ”, na základě generace a studie PreCog/Buňky rakoviny PreCrime-iPS jsou uvedeny na obrázku ਃ. Hypotetická Waddingtonova epigenetická krajinná struktura zobrazená na obrázku ਃ schematicky integruje koncepty hierarchie diverzifikace typů rakovinných buněk během vývoje rakoviny jako nemoci nebo přeprogramování a diferenciace. 86 - 88 Horizontální osa je schematicky promítnutá souřadnice stavového prostoru a elevace (kvazipotenciál) představuje relativní nestabilitu jednotlivých rakovinných buněčných stavů v každém vesmírném místě. Kuličky představují každý typ rakovinné buňky, definovaný konkrétní polohou ve stavovém prostoru. Každý typ rakovinných buněk v nádoru odpovídá jednomu z vysoce dimenzionálních atraktorů, které může v rakovinné tkáni produkovat velká síť stovek až tisíců genů. Atraktory regulačních sítí vykazují přirozené vlastnosti odlišných rakovinných buněčných stavů (tj. Typů rakovinných buněk), protože se jedná o diskrétně odlišné entity a samy se stabilizující (tj. Robustní vůči malým poruchám, ale tolerantní k 𠇊ll-or-nothing ” přechody na jiné atraktory dané dostatečným množstvím poruch). Atraktory se chovají jako nejnižší body v “ potenciálních studních ” nebo údolích, které jsou od sebe odděleny “hill topy ”, které odpovídají nestabilním stavům a představují bona fide epigenetické bariéry v krajině genomu rakoviny odvozené od pacienta. Nadmořská výška v kvazipotenciální energetické krajině však nepředstavuje skutečnou potenciální energii v klasickém smyslu, ale spíše pomáhá konceptualizovat globální dynamiku nerovnovážných systémů (jako jsou sítě pro regulaci genů) poskytováním informací o ȁrelativní hmotnosti ” různých údolí. Proto přesně poskytuje intuici typu gravitace, která by řídila pohyb hledající stabilitu v daném stavu rakovinotvorných buněk 𠇍ownward ”.

Obrázek ਃ. Xenopatients 2.0: Klíčové principy přeprogramování genomů rakoviny odvozených od pacienta z pohledu Waddingtonovy krajiny. Hypotetická epigenetická krajina vyobrazená v (A) ilustruje koncepty hierarchie diverzifikace buněčného typu během vývoje a lze jej také použít k ilustraci principů přitažlivého stavu 𠇌rater ” pluripotentních kmenových buněk na vrcholu zděných plošin a co lze očekávat od přeprogramování genomy rakoviny odvozené od pacienta (B). Horizontální osa je schematický, projektovaný stavový prostorový souřadnicový systém (elevace (kvazipotenciál)) představuje relativní nestabilitu jednotlivých stavů v každém místě stavového prostoru. Každý typ buňky, definovaný pozicí ve stavovém prostoru, je reprezentován koulemi. Čím více je buňka “plastic ”, tím výše na kopci je. Pluripotent stonku (S) je tedy nahoře, multipotent dále dolů, předek (P) pod tím a diferencovaný (D) dole. Kopce a údolí představují potenciální dostupné diferenciační cesty. Ke konkrétnímu povodí lze přistupovat z více než jedné cesty. Vezmeme-li se oklikou přes pluripotentní PreCrime-iPS (“jumping back to the summit ”), zajistíme výskyt robustního “groundového stavu ”, který se v kulturních podmínkách příznivých pro stav kmenových buněk sám udržuje globálně umístěný v ȁvysoké nadmořské výšce ”, což propůjčuje státu PreCrime-iPS silné nutkání spontánně a stochasticky se odlišit a obsadit všechny ostatní atraktory nacházející se na nižší 𠇊ltitude ” bez nutnosti “instructive &# x0201d signál pro vystavení genových expresních vzorců vlastněných jakýmkoli specifickým typem rakovinných buněk. V tomto scénáři, ve kterém má krajina genomu rakoviny 𠇍irection ” (tj. Jakmile se �ll ” zavázala ke svému sestupu, nemůže se sama vrátit zpět, očekává se, že neexistuje žádný požadavek na retrace vývojové cesty vnitřně zachycené v rakovině odvozené od pacienta) (tj. základní umístění rakovinotvorných buněčných stavů vzhledem k terénu diferenciace by bylo vnitřně určeno regulačními sítěmi genů, které již v nádoru existují díky samostabilizaci a paměťové vlastnosti atraktorů), jakmile signály aktivované v ortotopickém místě zploští kráter “pluripotency ” a umožní buňkám pohyb dolů po krajině. Cyklus rakovinotvorných buněk se bude odlišovat cestováním po rozsedlinách mezi údolími, někdy začínajícími po různých trajektoriích od začátku a jindy sdílením nejednoznačných osudů nahoře, které se definují při jejich pohybu po dráze. Waddingtonovská reprezentace indukované pluripotence v krajinných genomech rakoviny odvozených od pacienta intuitivně ilustruje představu, že různé stavy rakoviny lze časně (E) rekapitulovat (�k v čase ” PreCrime-iPS1) a/nebo pozdní (L) předpověď (“ dopředu v čase ” PreCrime-iPS2), jak je ukázáno na řezech úrovněmi odpovídajícími čarám v nejnižší krajině. Buňky jsou reprezentovány koulemi, osudy barvami.

Myšlenka stavového prostoru poskytuje koncepční rámec, který snadno vysvětluje, jak by na přeprogramování rakoviny mělo být nahlíženo jako na přechody mezi atraktory, a současně osvětluje, proč roubování biologicky agresivních rakovinných buněk získaných z pokročilých rakovinných stádií do imunodeficientních myší jako fragmenty nádorů, rozptýlené buňky nebo tříděné buňky u CSC markerů umožňuje okamžitou regresi k fenotypu pozdního stádia a tím nežádoucí prostorově časové omezení na rychle rostoucí, agresivní nádorové stadium, ze kterého byly injikované buňky odvozeny. Neúčinnost rakovinotvorných buněk naroubovaných do myší za účelem generování vysoce informativního výskytu fázově specifické exprese rakovinového genomu lze vysvětlit pomocí “ruggedness ” krajiny atraktoru. Očekává se, že heterogenní populace rakovinných buněk budou rozptýleny a obsadí více subatraktorů v atraktoru s povrchem “washboard ”.V tomto scénáři velký počet těchto mikrostavů v jakékoli populaci rakovinných buněk zejména rozptyluje profily odezvy při absenci silných (re) programových poruch. Jinými slovy, heterogenní populace rakovinných buněk, které jsou do značné míry refrakterní na diferenciační signály (které by je odstranily z atraktoru, aby obsadily nižší atraktory diferencovaných buněk nebo destabilizovaly atraktor, aby generovaly nové vzorce diferenciace), rychle znovu osídlí původní epigenetickou krajinu primární nádor, protože globální sklon v krajině také odpovídá šipce doby vývoje. Izolace extrémně vzácných populací podobných CSC na základě nepřítomnosti nebo přítomnosti několika molekulárních markerů může naopak obohatit buněčné stavy, které sedí na separatrixu (vrcholky kopců a hřebeny), které oddělují atraktory (tj. Delikátní stacionární stav, který je nestabilní a se rychle pohybuje buď k atraktoru v reakci na jakoukoli mírnou poruchu) nebo blízko okraje nádrže atraktoru (tj. skupina “outlierových buněk ”, které jsou připraveny k diferenciaci). Tento běžně používaný přístup nedokáže sladit vzácnost s robustností fenotypu podobného CSC, jak je definován různými libovolnými markery. Stručně řečeno, výška epigenetických bariér mezi diskrétními buněčnými fenotypy, vzdálenost stavového prostoru mezi buněčnými typy, členitost krajiny a heterogenita počátečních rakovinných buněk znemožňují expresi genomu rakoviny konkrétního jedince ve fázi- specifickým způsobem, na rozdíl od podstoupení okamžité regrese k fenotypu pozdního stádia, ze kterého jsou nádorové buňky běžně odvozeny v klasických přístupech myšího avatara. Při aktivaci již existujícího programu koherentní genové exprese exogenní stimulací přechodu do �ntrálního atraktoru ”, který kóduje takový program, by měl nastat jiný scénář. Můžeme být schopni generovat metastabilní atraktory s velkou, plochou pánví, která je obzvláště široká v pluri-/multipotentních buňkách a udržována v genovém okruhu kolem faktorů kmenové Yamanaky objížděním přes pluripotentní stav iPS, což umožňuje vyvážené, ale velké fluktuace na “scan ” prostor pro stav rakoviny a časově se přiblíží vzoru potenciální “lineage ” diferencovaných rakovinných buněk. Díky své centrální poloze ve stavovém prostoru mezi údolími, která představují jejich budoucí osudy, budou atraktory kmenových buněk generované z jednotlivých nádorů přirozeně vykazovat promiskuitní genovou expresi a budou mít přístup k atraktorům různých typů rakovinných buněk. Tyto atraktory podobné kmenovým buňkám budou umístěny v ȁvysoké nadmořské výšce ” v krajině a tyto buněčné státy poskytnou silnou nutnost 𠇏low down ” údolí a 𠇍ifferentiate away ” osídlením všech ostatních atraktory rakovinných buněk nacházející se na nižší 𠇊ltitude ”. Dobře uznávaná tendence buněčných linií iPS přednostně se diferencovat do svých původních linií by se měla promítnout do preference PreCog/Rakovinové buňky PreCrime-iPS k regeneraci typu rakoviny, ze kterého byly získány. Buňky PreCog-iPS se mohou spontánně a stochasticky diferencovat na všechny buněčné typy obsažené v zachyceném genomu rakoviny, aniž by byl zapotřebí signál “instructive ” pro přenos vzorců genové exprese vlastněných konkrétními stavy rakovinných buněk, jak se vyskytuje u multipotentního předka buňky nebo embryonální kmenové buňky, pokud jsou umístěny do kultivačních podmínek nepříznivých pro stav kmenových buněk. Po znovuzavedení pluripotence v dobré víře tlačením rakovinotvorných buněk odvozených od pacienta k novému osudu v bitvě “uphill ” mohou být buňky iPS v avatarech myší PreCrime schopny “roll down ” směrem k více možným výsledkům než původně existovaly v pacientově tumoru, protože proces přeprogramování implikuje restrukturalizaci epigenetické krajiny a stabilizaci přechodových stavů. Úspěšné generování všech rozhodnutí o osudu rakovinných buněk v daném prostředí genomu rakoviny nebylo možné dosáhnout spontánně v žádném rozumném časovém měřítku za použití v současné době dostupných strategií avatar myší, protože by jich mělo být dosaženo prostřednictvím přechodů mezi vysoce dimenzionálními atraktory. Nukleární přeprogramování rakovinotvorných buněk odvozených od pacienta může rychleji identifikovat pochůzné cesty, které spojují stávající nebo 𠇏uture ” atraktory, protože by to mohlo vytvořit všechny předprogramované stavy atraktorů, které mohou případně vzejít z genových regulačních sítí obsažených v daném genom genů rakoviny odvozený od pacienta.

Důsledek

Naše současná schopnost zotavit se nebo předvídat evoluční trajektorii jakékoli jednotlivé rakoviny zůstává v plenkách. Předpokládali jsme hypotézu, že pluripotentní nebo téměř pluripotentní linie kmenových buněk generované z rakovinných buněk odvozených od pacienta by měly mít schopnost postupovat mnoha, ne-li všemi, vývojovými stádii rakoviny na základě nedávno uznané schopnosti kultivovaných nádorových buněk přeprogramovat na pluripotenci jaderným přeprogramováním. Můžeme vytvořit samo-vyvíjející se vývojová okna zachyceného genomu rakoviny a obnovit minulé události v rychle rostoucích typech lidských karcinomů manipulací s přirozeně se vyskytujícími událostmi přeprogramování v nádorových tkáních. V důsledku toho nám tento přístup k progresi živých buněk poskytne nepředvídatelné experimentální prostředí, ve kterém mohou být objeveny časné molekulární markery pro vnitřně agresivní nádory, které se rychle vyvíjejí do agresivních stadií rakoviny odolných vůči léčbě. Přeprogramování epigenetických krajin genomů rakoviny odvozených od pacienta pomocí faktorů Yamanaka kmenů by mělo generovat nejmodernější buněčné nástroje k odhalení biologických vlastností a molekulárních rysů, které nebudou patrné v pokročilém stádiu, ve kterém se vzorky nádorů obecně získávají k posouzení diagnostických a prognostických parametrů. Jaderné přeprogramování rakovinotvorných buněk odvozených od pacienta navíc může generovat “předcházejících krajin ”, které nás mohou předem informovat o budoucnosti jednotlivých nádorů a výskytu neortodoxních mezibuněčných vývojových cest v nádorových tkáních. Navrhované modely by mohly testovat potenciální terapie k blokování specifických vývojových stádií onemocnění. Nová éra myších avatarů (xenopatientů) 2.0 by proto mohla revolučně transformovat aktuálně dostupné personalizované translační platformy a výrazně zlepšit naše nástroje pro screening léků, diagnostiku a personalizovanou léčbu.


Počáteční nabídky mincí (ICO) v dnešní době pohánějí většinu světla a tepla ve světě blockchainu. Lidé získávají obrovské částky v kryptoměnách pro podniky s někde mezi malou věrohodností a běžnou úrovní věrohodnosti spuštění. V mnoha ohledech to hodně připomíná poslední roky internetové bubliny, když existuje mnoho paralel. Toky financování mohou být poháněny nějakou kombinací lidí, kteří obcházejí čínské měnové kontroly, dřívější držitelé bitcoinů a etheru diverzifikují své držby v rámci blockchainového ekosystému a různé velké investiční problémy, jejichž majitelé zjistili, že si mohou rychle vydělat překlápěním tokenů blockchainu , to vše přilévá olej do ohně. Jak jsem se ptal na začátku tohoto roku, mohou -li dosti pochybné podniky získat desítky milionů dolarů, proč bychom to nemohli použít k financování promyšlených a legitimních iniciativ ve výzkumu omlazení? Úkol zde spočívá v nalezení smysluplného využití blockchainů a síťových efektů v našem světě výzkumu a vývoje.

Některé skupiny s tímto úsilím postupují vpřed. Zmínil jsem ICO Open Longevity, ve kterém se snaží financovat kolaborativní lidské pokusy s různými potenciálními farmaceutickými prostředky pro zpomalení stárnutí, ale v dnešní době se pozornost zaměřuje na Youthereum Genetics, novější podnik, který se také snaží využít ICO jako mechanismus financovat výzkum a vývoj. Ředitelé Youthereum původně zamýšlejí pracovat na způsobu, jak dodat faktory pluripotence, které se podílejí na tvorbě indukovaných pluripotentních kmenových buněk, aby podpořily regeneraci. Demonstrace toho byla provedena výzkumnou skupinou a zveřejněna na začátku tohoto roku, což vedlo k prospěchu progeroidních myší často používaných ve výzkumu stárnutí v rané fázi. To bylo do určité míry překvapivé: nahodilá indukce buněk, aby se staly pluripotentní v živém organismu, zní jako rychlý zkrat k rakovině.

Dalšími kroky bude vyzkoušet to u normálních myší, kvantifikovat nejužitečnější dávku a způsob podávání a nadále pečlivě sledovat důkazy o rakovině jako vedlejším účinku. V nejlepším případě to může být cesta k regenerační terapii analogické s transplantacemi kmenových buněk, ale to se teprve uvidí. Jako v tolika oblastech výzkumu, kde zajímavé výsledky mohou, ale nemusí být před námi, je první otázkou, kde se finanční prostředky na tuto práci najdou. Tým Youthereum doufá, že cesta na trh blockchainu je tou správnou cestou.

Nedávno jsem měl možnost chatovat s Yuri Deiginem z Youthereum Genetics a položit několik otázek o jeho cílech. Jak můžete říci, postupuje z hlediska programovaného stárnutí - něco, co mám tendenci prezentovat jako stojící v diametrálním protikladu k mainstreamovějšímu pohledu na stárnutí jako nahromaděné poškození. Možná je to zjednodušení, je to otázka, zda ve stárnutí epigenetická změna (program) způsobuje poškození, nebo zda poškození způsobuje epigenetickou změnu (reakce). Naprogramovaný pohled na stárnutí vede k zásahu do procesů, které jsou z hlediska nahromaděného poškození pouze sekundárními důsledky a útočit na sekundární důsledky nebude příliš účinné. Jsme blízko let, ve kterých bude jedna nebo druhá strana definitivně prokázána správná, díky implementaci specifických přístupů k léčbě stárnutí jako zdravotního stavu.

Nic však není úplně černobílé a je zajímavé sledovat vývoj oblastí, kde se teoretici z obou stran tohoto předělu setkají uprostřed při přístupech k terapiím, které oba budou považovat za potenciálně dostatečně užitečné k vyzkoušení, ale z různých důvodů . Některé třídy terapií kmenovými buňkami a snahy dosáhnout podobných účinků prostřednictvím změn v signalizaci nebo přeprogramování buněk in situ spíše než prostřednictvím přenosu buněk jsou dobrým příkladem tohoto typu. Z hlediska programovaného stárnutí jsou to páky, pomocí kterých lze změnit epigenetickou signalizaci na mladistvější úrovně, zatímco z hlediska nahromaděného poškození by mohly být v podstatě kompenzační povahy, jako terapie kmenovými buňkami, ale pro některé jsou slabé. stupeň pro nativní regenerační procesy, které jsou brzděny poškozením.

Proč Youthereum Genetics a proč právě teď? Kdo jste a jak tato organizace vznikla?

Jsem rusko-kanadský transhumanistický aktivista dlouhověkosti, amatérský teoretický biolog a biotechnologický podnikatel. Dříve se tyto oblasti mého života neprotínaly, ale v posledních několika měsících se hvězdy spojily, aby mě přiměly konečně spojit svou vášeň a odbornost a nasměrovat je do podniku, který považuji za nejdůležitější v životě: vyléčení stárnutí. Nebo - sesednout z vysokého koně - alespoň vyvinout nějaké významné terapie prodloužení života pro lidi, protože v tuto chvíli žádné neexistují. „Významným“ mám na mysli něco, co nám může prodloužit život minimálně o 30%. Žádná terapie mimo kalorické omezení nebyla schopna dosáhnout tohoto milníku ani u myší - ani rapamycin (26%), ani metformin (14%), ani telomeráza (24%), ani senolytika (26%) ani žádný jiný „geroprotektor“ . A kalorická restrikce, která drží rekord v prodloužení délky života mimo genetiku (až 50% u různých hlodavců), nepřinesla u primátů ani zdaleka tak velkolepý výsledek. Ve dvou studiích makaků provedených na CR bylo u žen pozorováno maximálně 10% prodloužení střední délky života a v některých skupinách CR skutečně zkrátilo životnost.

Osobně se domnívám, že důvod této neschopnosti způsobit výrazné stárnutí v posledních 50 a více letech spočívá v jeho naprogramované povaze. Za ta léta jsem viděl spoustu důkazů na podporu této hypotézy, přičemž nejpřesvědčivější jsou výsledky parabiózy a experimentů s mladou plazmou. Myslím si, že stárnutí je nakonec řízeno hypotalamem, stejně jako všechny ostatní aspekty ontogeneze. Tento koncept pochází z 50. let minulého století a je podrobně popsán v dílech Dilmana, Frolkise a Everitta. Nedávný výzkum Dongsheng Cai a jeho kolegů poskytuje další důkazy pro hypotalamickou hypotézu. Na buněčné úrovni je stárnutí pravděpodobně sledováno a prováděno epigenetickou regulací genové exprese. Před několika lety bylo poprvé pozorováno, že věk člověka vysoce koreluje s jeho epigenetickým profilem. Později bylo uznáno, že tyto „epigenetické hodiny“ jsou účinnými prediktory délky života, což potvrdilo, že epigenetika je klíčovou součástí procesu stárnutí. Bylo zjištěno, že mnoho organismů má takové „epigenetické hodiny“, které vysoce korelují jak s jejich věkem, tak s pravděpodobností smrti.

Navíc příroda ví, jak vrátit zpět nebo dokonce úplně resetovat epigenetické hodiny. Dělá se to pro každé nové embryo a je to pravděpodobně důvod, proč se každé nové zvíře narodí mladé, přestože začalo jako oocytová buňka stejného věku jako jeho matka (protože oocyty matky se vytvářely, zatímco ona sama byla ještě v děloze). Nakonec experimenty s epigenetickým omlazením, které ukázaly, že vrácení epigenetiky omlazuje nejen jednotlivé buňky, ale celé organismy (a prodlužuje jejich životnost) potvrdily, že epigenetika není jen důsledkem, ale důležitým hybatelem nebo stárnutím. Zde přichází na řadu Youthereum Genetics. Na základě nedávné práce skupiny Juana Carlose Izpisua Belmonte v Salku, která ukázala, že periodická indukce transkripčních faktorů OSKM může prodloužit životnost progerických myší až o 50%, předpokládáme, že stárnutí může být vráceny zpět periodickými epigenetickými rollbacky. Naše strategie je zaměřena na převedení této hypotézy na bezpečnou terapii, která u lidí produkuje značné a znatelné omlazení.

Proč my a proč právě teď? Stručně řečeno, protože jsem byl příliš unavený čekáním, až to udělá někdo jiný, a neviděl jsem nikoho stoupat na talíř. Sestavil jsem tedy tým, který je schopen navrhovat a dohlížet na experimenty pro všechny kroky zahrnuté v prvním ověření vědy za naší hypotézou a následném převedení do terapie, pokud by věda obstála. Jediné, co teď zbývá udělat, je malá věc sehnat potřebné finance. Samozřejmě jsem sarkastický. Je to obrovská výzva, zejména s ohledem na požadované množství a související vědecká rizika. Ale jsem ochotný to zkusit, i přes vysoké šance proti.

Jaký je váš model toho, co se děje pod pokličkou u zvířat transfekovaných faktory pluripotence? Proč přináší výhody?

Jak jsem již zmínil, jsem z kultu programovaných svědků stárnutí. Alespoň tak nám říkají někteří odpůrci programovaného stárnutí. Věřím, že většina, ne-li všechny formy různých intra- a intercelulárních poškození, které vidíme, jak se tělo hromadí s věkem, tak činí, protože naše buňky postupně zeslabují objem různých mechanismů opravy poškození. Naše buňky to dělají epigenetickou regulací různých genů po přijetí endokrinních signálů, které pocházejí z hypotalamu na základě cirkadiánních rytmů a nějakých vnitřních hodin. Víme, že existují hodiny, protože vidíme, jak jemně je načasováno různé vývojové a cyklické procesy - od embryogeneze přes pubertu až po menstruační cykly.

Domnívám se tedy, že tělo má dostatečnou kapacitu pro vlastní opravu, aby fungovalo na úrovni 25letého člověka po stovky, ne-li tisíce let, nebo možná ještě déle. Pokud to zárodečná linie dokáže po miliardy let a periodicky generuje nový organismus od nuly, zdá se mi logické, že jen zlomek těchto pozoruhodných kulturistických schopností by měl stačit na to, aby naše těla vydržela mnohem, mnohem delší období, než vidíme. dnes. Pokud tedy najdeme způsob, jak přimět naše buňky, aby si myslely, že je nám 25, budou fungovat (a budou doplněny) na úrovni 25 let bez ohledu na náš chronologický věk. K tomu by museli mít profily genové exprese (epigenetické profily) typické pro 25leté lidi. A z díla Hannuma a Horvatha víme, že epigenetické profily 25letých se značně liší od profilů 45letých a 65letých.

Když tedy v buňkách indukujeme faktory OSKM, myslím, že se stane epigenetické převíjení, které je spojeno s upregulací různých opravných mechanismů. Je empirickým faktem, že indukované pluripotentní kmenové buňky zažívají významné omlazení, které zlepšuje prakticky všechny slavné znaky stárnutí: telomery se prodlužují, fixují se laminární defekty, obnovuje se mitochondriální funkce a tak dále. O tom je skvělý článek od Vittoria Sebastiana a Tapash Jaye Sarkara ze Stanfordu se spoustou podrobností.

To znamená, že člověk nemusí věřit v programované stárnutí, aby viděl potenciál epigenetického omlazení pro účely prodloužení života. Ve skutečnosti Aubrey de Gray, který je jedním z našich poradců, přestože je zapřisáhlým odpůrcem naprogramované hypotézy, také věří, že epigenetický rollback je terapeutickým příslibem. Podle jeho názoru schopnost omladit staré tělo reaktivací drah v raném věku není v žádném případě v rozporu s myšlenkou, že stárnutí není naprogramováno a vyplývá spíše z mezer v našem zařízení proti stárnutí, než z přítomnosti aktivně podporujícího stárnutí. stroje. Byl bych více než šťastný, kdyby se ukázalo, že se mýlí v základních mechanismech epigenetického omlazení, pokud nám to poskytne prodloužení životnosti srovnatelné s tím, co je vidět v Belmonteově práci.

A naopak, proč tato léčba nevyvolá nepřijatelnou úroveň rizika rakoviny? To je v takových věcech vždy problém.

Teratomy jsou pravděpodobně největší starostí tohoto přístupu. Ve skutečnosti, než Belmonte ukázal, že existuje Goldilocksova zóna indukce OSKM, která prodlužuje životnost bez produkce teratomů, riziko rakoviny tohoto přístupu bylo považováno za prohibitivní pro jeho překlad. Očividně není. Jde o to, vrátit buňky tak mírně zpět, aby se zabránilo jejich de-diferenciaci, ale dělat to dostatečně často, aby se zabránilo (nebo alespoň zpomalilo) hromadění poškození souvisejícího s věkem, které je důsledkem neutuchající downregulace opravy poškození mechanismy s věkem.

Jak to zapadá do vašeho pohledu na stárnutí? Co očekáváte od tohoto a dalšího úsilí v příštích letech? Kde byste očekávali, že se objeví největší výhry?

To odpovídá mému pohledu na stárnutí jako ulité. Ve skutečnosti jsem byl v únoru tak nadšený výsledky Belmonte proto, že než jsem se o nich dozvěděl, předpokládal jsem, že pokud se někdy naučíme vrátit zpět epigenetické změny, periodické dělání nám může poskytnout dostatečně dobrý „hack“ na výrazně oddálit stárnutí, dokud úplně nerozluštíme jeho mechanismy a nenaučíme se je nadobro zastavit.Takže epigenetické omlazení je přesně tam, kde si myslím, že by mohly nastat největší zisky v prodloužení života. Jedna další důležitá oblast, kterou také plánujeme prozkoumat na Youthereum, i když v samostatné výzkumné trase, se pokouší dekódovat sekrece hypotalamických exozomů. Myslíme si, že nejnovější dokument Dongsheng Cai, který ukázal, že 16měsíční myši vykazují známky omlazení po jednorázové injekci hypotalamických exozomů izolovaných z kultivovaných kmenových buněk hypotalamu neuronů, je opravdu na něčem.

Řekněte nám o svém pohledu na to, jak sloučit tok finančních prostředků na trhu blockchain s cílem udělat něco užitečného ve vědě o dlouhověkosti. Tolik z toho, co se děje v prostoru ICO, se zdá být velmi neobratnou snahou přišroubovat jednu věc, blockchain, k jiné zcela nesouvisející věci, která s blockchainem nemá logické spojení. V čem jsi jiný?

Nesnažíme se předstírat, že něco přispějeme do blockchainové infrastruktury. Nebudeme, jsme decentralizovaný projekt crowdfundingu biotechnologií, který získává peníze především na vědecký výzkum. Jinými slovy, jsme uživatelé technologie blockchain, nikoli její vývojáři. Plánujeme jej použít k odstranění všech prostředníků mezi námi a našimi přispěvateli do financování a zajistit, aby veškerá práva našich podporovatelů na terapie, které plánujeme vyvinout, nebyla ovlivněna různými vládními byrokracemi - současnými ani budoucími. To jsou podle nás dva hlavní přínosy decentralizace. Považujeme tedy ICO pouze za efektivnější mechanismus crowdfundingu, i když to způsobí, že se někteří blockchainoví puristé přikrčí. Nejsem si však jistý, proč by se krčili - přijetím paradigmatu blockchainu a přenesením projektů z reálného světa do jejich říše ve skutečnosti ověřujeme jejich technologii a výrazně rozšiřujeme jeho potenciální uživatelskou základnu.

Jak se liší Genetika Youthereum od Open Longevity, kteří zkouší vlastní ruku na ICO?

Zatímco Michail Batin z Open Longevity a já souhlasíme s tím, že potřebujeme více lidí, aby udělali vše možné pro rozvoj radikálních terapií prodloužení života ASAP, lišíme se v tom, jaké druhy intervencí by ve skutečnosti mohly takové prodloužení života vyvolat. Věřím, že žádná terapie, která dnes existuje, včetně jakýchkoli klinicky schválených léků, nemůže prodloužit náš život o více než 10%, natož o 30%. Podle mého názoru není provádění klinických studií pro dietu napodobující půst (FMD) nebo používání statinů, aby se zjistilo, zda mají potenciál prodloužit životnost, příliš užitečné. Epigenetické omlazení na druhou stranu má podle mého názoru potenciál prodloužit naši životnost o více než 30% nebo dokonce mnohem, mnohem větší. Proto na to sázím tolik času a peněz.

Pokud to všechno půjde dobře a budete pohřbeni ve finančních prostředcích se slušnými zvířecími údaji o využití faktorů pluripotence jako terapie, co dál?

Pokusím se na to odpovědět tím, že nejprve popíšu náš plán výzkumu. Máme v úmyslu jej rozdělit na 3 paralelní výzkumné okruhy: (1) vývoj optimálního dávkovacího režimu pomocí faktorů OSKM (2) hledání bezpečnějších faktorů epigenetického rollbacku, které nevedou k úplné de-diferenciaci (3) vytvoření nejlepších prostředků dodání genu, výhodně patentovatelný. Naše klíčová hypotéza tedy zní: Abychom spolehlivě omladili celé tělo, potřebujeme pravidelně vrátit epigenetické hodiny většiny buněk v těle, ne -li všech buněk. Díky práci Belmonteovy skupiny víme, že je to možné dodáním faktorů OSKM (nebo jiných transkripčních faktorů) do buňky. Je to však ošemetná snaha: vrátit se příliš málo a nedostanete žádný značný efekt, vrátit se příliš mnoho a můžete dostat rakovinu, protože buňky ztratí svou identitu a stanou se opět pluripotentními. Koneckonců, jejich schopnost přeměnit buňky zpět do pluripotentního stavu byla hlavním kritériem výběru pro výběr 4 faktorů OSKM z původních 24 kandidátů. I když jsou faktory OSKM účinné a představují „ptáka v ruce“, nejsou pro naše účely zdaleka ideální.

Měli bychom se snažit najít lepší, bezpečnější epigenetické faktory vrácení, které plánujeme začít, přehodnocením zbývajících 20 faktorů původních 24 Yamanaka, a také se pokusit použít samotný faktor Oct4, protože existují důkazy, že je sám schopen vrátit epigenetiku a je obecně hlavním „strážcem epigenetických bran“. Zúžení faktorů je však pouze polovinou výzvy. Doručit je bezpečně a v ideálním případě levně je druhá polovina. Program epigenetického stárnutí je docela robustní i tváří v tvář týdenním rollbackům, jak prokázali Belmonte et al., Proto získání smysluplného omlazení u lidí by s největší pravděpodobností vyžadovalo měsíční nebo dokonce týdenní indukci epigenetických rollback faktorů (ať už OSKM nebo jinak). Nejhospodárnějším způsobem, jak toho dosáhnout, by bylo integrovat speciální, normálně tichou polycistronickou kazetu obsahující geny pro faktory vrácení do prakticky každé buňky pacienta. Taková kazeta by byla aktivována jedinečným a normálně inertním vlastním agentem, který by bylo nutné vyvinout samostatně, a umožnil by tento přístup patentovat. Dnes jsou takové kazety aktivovány například tetracyklinem nebo doxycyklinem. S tímto přístupem by mezní náklady na týdenní indukci omlazujících faktorů byly pouze náklady na indukční činidlo (pravděpodobně malou molekulu nebo peptid) - poměrně levné.

V souhrnu vidíme nejoptimálnější plán výzkumu jako krok za krokem, iterativní zlepšení již osvědčeného přístupu, indukci faktorů OSKM doxycyklinem, takovou kazetu s faktory OSKM lze do těla dodat pomocí dostupného lentivirového nosiče na dnešním trhu. To bude probíhat souběžně s vývojem ideální terapie: maximálně bezpečných a účinných faktorů aktivovaných jedinečným, inertním, patentovatelným prostředkem. Patentovatelnost je zásadní pro to, abyste mohli společnost Big Pharma zaujmout licencováním této terapie po dosažení fáze IND. Pokud se projekt úspěšně dostane do fáze IND, věříme, že společnosti Big Pharma si pak budou tuto terapii licencovat pro zahájení klinických studií, nejprve pro prevenci aterosklerózy, Alzheimerovy choroby, diabetu nebo jiných indikací souvisejících s věkem, které léky proti stárnutí používají dnes pro regulační účely, jelikož stárnutí samo není WHO klasifikováno jako indikace. Stručně řečeno, to je náš plán - dostat terapii do fáze IND a pak nechat Big Pharma dělat to, co umí nejlépe: klinicky ověřit. Odhadujeme, že dostat se do fáze IND by trvalo 5-6 let, pokud vše půjde dobře.

„vytvoření nejlepšího způsobu přenosu genů, nejlépe patentovatelného“.

Kmenové buňky byly nyní (téměř) vytvořeny pomocí protilátek:

"Tým TSRI objevil dvě protilátky, které mohou být nahrazeny jak Sox2, tak c-Myc, a v podobném souboru testů našli dvě protilátky, které mohou nahradit třetí transkripční faktor, Oct4. Vědci ukázali, že místo vložení těchto transkripčních faktorů geny, které by mohly jednoduše dodat protilátky do buněk fibroblastů v kultuře.

V této počáteční studii vědci nebyli schopni najít protilátky, které by nahradily funkci čtvrtého transkripčního faktoru OSKM, Klf4. Baldwin však očekává, že s rozsáhlejším screeningem nakonec ona a její kolegové najdou také náhražky protilátek pro Klf4. „Myslím, že to bude trvat ještě několik let, než to zjistíme,“ řekla.

Také mini proteiny mohou být mnohem jednodušší a levnější než protilátky:

"" Tato mini-proteinová pojiva mají potenciál stát se novou třídou léčiv, která překlenou propast mezi léky s malou molekulou a biologickými látkami. Stejně jako monoklonální protilátky mohou být navrženy tak, aby se vážily na cíle s vysokou selektivitou, ale jsou stabilnější a snáze se produkují a podávají, “řekl Dr. Baker, který s kolegy publikoval svou studii v Nature („ Massively Parallel De Novo Protein Design pro Targeted Therapeutics “).

Tato technika se opírá o počítačovou platformu Rosetta, vyvinutou Dr. Bakerem a kolegy z University of Washington. Navrhli tisíce krátkých proteinů o délce asi 40 aminokyselin, které program Rosetta předpovídal, že se pevně naváží na molekulární cíl. "


Podívejte se na video: Lecture on JJ Rousseau The Social Contract (Listopad 2021).