Informace

Do jaké míry ovlivňuje ztráta neuronů v substantia nigra pohyb?


Existuje látka známá jako MPTP, která je schopná překročit hematoencefalickou bariéru. Jakmile to udělá, metabolizuje se na toxin zvaný MPP+, který pak selektivně ničí dopaminergní neurony v mozku substantia nigra pars compacta, což způsobuje parkinsonismus. Tento účinek MPTP byl objeven, když jím byli v 80. letech minulého století otráveni uživatelé drog.

Jak velký účinek má tato destrukce neuronů na pohyb? Byli tito pacienti v důsledku toho zcela paralyzováni, nebo si zachovali určitou schopnost dobrovolného pohybu?


Skvělé otázky! Zde je několik rychlých odpovědí, ale pokud vás to zajímá, dám na konci další malé doporučení:

Jak velký účinek má tato destrukce neuronů na pohyb?

  • Odpověď: Velký efekt. Klíčovým pojmem je zde „parkinsonismus“, což znamená, že příznaky připomínají Parkinsonovu chorobu. To často zahrnuje motorické příznaky, jako je míchání chůze, třes, tuhost a bradykineze (což znamená pomalý pohyb). I když obvykle nevedou k úplné paralýze, tyto příznaky mohou být oslabující a vyžadují léčbu, jako je L-dopa.

Byli tito pacienti v důsledku toho úplně paralyzováni, nebo si zachovali určitou schopnost dobrovolného pohybu?

  • Odpověď: Obecně byli tito pacienti stále schopni pohybu, ale velmi se potýkali s kontrolovanými pohyby. Jak je uvedeno výše, Parkinsonismus/Parkinsonova choroba je poznamenána mnoha motorickými příznaky, které však nevedou k úplné paralýze. Spíše ztěžují a zpomalují dobrovolné pohyby. Podle dokumentu nazvaného „Příběh MPTP (doi: 10.3233/JPD-179006)“ se zdá, že alespoň jeden pacient byl téměř (ne-li zcela) katatonický a vykazoval velmi málo dobrovolných pohybů.

Pokud byste chtěli vědět proč to je případ Parkinsonismu a Parkinsonovy choroby, doporučuji vám vyhledat online přímé a nepřímé cesty bazálních ganglií. Existuje pravděpodobně dobrá přednáška s užitečným obrazem o tom, jak tyto cesty fungují k usnadnění (přímého) a inhibování (nepřímého) pohybu svými účinky na thalamus a motorickou kůru. Případně mi můžete prostřednictvím odpovědi sdělit, že máte zájem, a já se budu snažit vysvětlit tyto cesty zde. Snad to pomůže!


Dopamin

V době, kdy člověk sedí před neurologem a říká mu, že má Parkinsonovu chorobu, ztratí polovinu buněk produkujících dopamin v oblasti mozku zvané střední mozek.

Na této stránce vysvětlíme, co je dopamin a jak souvisí s Parkinsonovou nemocí.

Dopamin je uvolňován jednou buňkou a váže se na jinou. Zdroj: Truelibido

Dopamin je chemická látka, která hraje roli v mnoha základních funkcích mozku, jako je koordinace motorů, odměna a paměť. Funguje jako signální molekula a#8211 způsob, jak mozkové buňky navzájem komunikují. Dopamin se uvolňuje z mozkových buněk, které produkují tuto chemikálii (ne všechny mozkové buňky to dělají), a váže se na cílové buňky, čímž v těchto buňkách zahájí biologický proces.

Dělá to prostřednictvím pěti různých receptorů –, to znamená, že dopamin se uvolňuje z jedné buňky a může se vázat na jeden z pěti různých receptorů na cílové buňce (v závislosti na tom, který receptor je přítomen). Receptor je analogický zámku a dopamin je klíč. Když se dopamin naváže na konkrétní receptor, umožní to, aby se v té buňce něco stalo. A takto se informace z dopaminového neuronu předávají nebo přenášejí do jiné buňky. Z tohoto důvodu je dopamin označován jako a neurotransmiter.

Pět různých dopaminových receptorů lze seskupit do dvou populací na základě účinku zahájeného vazbou dopaminu. Dopaminové receptory 1 a 5 jsou považovány za receptory podobné D1, zatímco dopaminové receptory 2,3 a 4 jsou považovány za receptory podobné D2. Prostřednictvím těchto různých receptorů má dopamin vliv na mnoho různých činností mozku, zejména na motorickou koordinaci.

Dopamin v motorické koordinaci

Když plánujete hýbat rukou nebo nohou, proces potřebný pro skutečné zahájení této akce začíná v oblasti mozku zvané motorická kůra. Probíhá přes samotný vrchol vašeho mozku – od těsně nad vaším chrámem až k temeni vaší lebky. A motorická kůra je rozdělena do oblastí, které ovládají konkrétní části těla (například nohy jsou ovládány samotnou horní částí motorické kůry, zatímco ústa a jazyk jsou ovládány oblastmi blíže k vašim chrámům.

Zatímco myšlenka zahájení pohybu začíná v motorické kůře, vaše schopnost skutečně se pohybovat je do značné míry řízena aktivitou v určité skupině oblastí mozku, souhrnně známých jako „Bazální ganglia‘.

Umístění struktur bazálních ganglií (modré) v lidském mozku. Zdroj: iKnowledge

Bazální ganglia přijímá signály z překrývající se motorické kůry, zpracovává tyto informace před odesláním signálu dolů po míše do svalů, které budou provádět pohyb.

Představte si motorickou kůru jako vzrušené děti, které chtějí něco udělat, a bazální ganglia jako rodičovské postavy rozhodující o tom, zda je tato akce dobrý nápad.

A nejdůležitějším účastníkem těchto bazálních ganglií ‘ regulace ’ pohybu je struktura zvaná thalamus.

Mozek ilustrující umístění thalamu v lidském mozku. Zdroj: Wikipedia

Thalamus je struktura hluboko uvnitř mozku, která funguje jako centrální řídicí jednotka mozku. Všechno, co přichází do mozku z míchy, prochází thalamem. A vše, co opouští mozek, prochází thalamem. Je si vědom většiny všeho, co se děje, a hraje důležitou roli v regulaci pohybu.

Přímé/nepřímé cesty

Zpracování pohybu v bazálních gangliích zahrnuje a přímá cesta a nepřímá cesta. Jednoduše řečeno, přímá dráha povzbuzuje pohyb, zatímco nepřímá cesta dělá opak (brzdí ji). Obě cesty fungují společně jako pečlivě choreografická symfonie.

Motorické rysy Parkinsonovy choroby (zpomalení pohybu a klidový třes) jsou spojeny s poruchou zpracování těchto dvou drah, což má za následek silnější signál přicházející z nepřímé dráhy - tedy inhibici/zpomalení pohybu.

Budící signály (zelené) a inhibiční signály (červené) v bazálních gangliích, v normálním mozku i v případě Parkinsonovy choroby. Zdroj: Animal Physiology 3. vydání

Přímá i nepřímá cesta končí v thalamu, ale jejich účinky na thalamus jsou velmi odlišné. Přímá dráha opouští thalamus vzrušený a aktivní, zatímco nepřímá cesta způsobuje, že je thalamus inhibován.

Thalamus bude přijímat signály ze dvou cest a poté se - na základě těchto signálů - rozhodne, zda pošle do kůry excitační nebo inhibiční zprávu a řekne jí, co má dělat („vzrušit se a hýbat“ nebo „nevzrušovat se a nehýbejte se “).

Kde přichází dopamin na obrázek?

U Parkinsonovy choroby často hovoříme o ztrátě dopaminových neuronů ve středním mozku jako o hlavním rysu onemocnění. Když je lidem diagnostikována Parkinsonova choroba, obvykle ztratili přibližně 50–60% dopaminových neuronů v oblasti mozku nazývané substantia nigra.

Tmavě pigmentované dopaminové neurony v substantia nigra jsou redukovány v mozku Parkinsonovy choroby (vpravo). Zdroj: Memorangapp

Střední mozek je - jak naznačuje štítek - uprostřed mozku, těsně nad mozkovým kmenem (viz obrázek níže). Sídlí tam dopaminové neurony substantia nigra.

Umístění substantia nigra ve středním mozku. Zdroj: Memorylossonline

Dopaminové neurony substantia nigra generují dopamin a uvolňují tuto chemikálii v různých oblastech mozku. Primární oblasti tohoto uvolnění jsou oblasti mozku zvané putamen a Kádové jádro. Dopaminové neurony substantia nigra mají dlouhé projekce (nebo axony), které zasahují dlouhou cestu přes mozek do jádra putamenu a kaudátu, takže tam může být dopamin uvolněn.

Projekce dopaminových neuronů substantia nigra. Zdroj: MyBrainNotes

U Parkinsonovy choroby tato „axonová“ rozšíření, která vyčnívají do jádra putamenu a kaudátu, postupně mizí, protože se ztrácí dopaminové neurony substantia nigra. Když se podíváme na mozkové části putamenu poté, co byly axony označeny technikou tmavého barvení, je tato redukce axonů v průběhu času velmi patrná, zvláště ve srovnání se zdravým kontrolním mozkem.

Putamen u Parkinsonovy choroby (v čase). Zdroj: Brain

UPOZORNĚNÍ REDAKCE: RÁD BYCH RÁD PŘIDAL, ŽE VÝŠE UVEDENÝ OBRÁZEK ​​NENÍ ZÁSTUPCEM KAŽDÉHO S PARKINSONEM. OBRÁZEK ​​SE POUŽÍVÁ ZDE K POSKYTNUTÍ PŘÍKLADU ZTRÁTY DOPAMINOVÉHO VLÁKNA POZOROVANÉ V PUTAMENU. TENTO PROCES MŮŽE U NĚKTERÝCH JEDNOTLIVCŮ trvat DÉLE, NEŽ JE UVEDENÁ DOBA ČASU.

Za normálních okolností dopaminové neurony uvolňují dopamin v bazálních gangliích, který excituje přímou cestu a inhibuje nepřímou cestu. Působí jako druh maziva pro pohyb.

Se ztrátou dopaminových neuronů u Parkinsonovy choroby však dochází k zvýšenému množství aktivity v nepřímé dráze. V důsledku toho je thalamus udržován inhibovaný. S tlumeným thalamem má překrývající se motorická kůra problém se vzrušit, a proto motorický systém není schopen správně fungovat. A to je důvod, proč lidé s Parkinsonovou nemocí mají potíže se zahájením pohybu.

Lidé s Parkinsonovou chorobou budou při diagnostice často testováni skenováním mozku nazývaným skenování DAT. Výsledky této zobrazovací techniky hodnotí množství dopaminu uvolňovaného v putamenu. Výsledkem je horizontální obraz mozku prezentovaný na obrazovce počítače s červenými (horkými) oblastmi, které se překrývají s umístěním putamenu u zdravých jedinců, což naznačuje normální uvolňování dopaminu. U lidí s Parkinsonovou nemocí však dochází k významnému snížení uvolňování dopaminu (kvůli menšímu počtu dopaminových neuronů, které vytvářejí dopamin), což má za následek menší červené zbarvení obrazu na obrazovce počítače na mozku. U lidí s Parkinsonovou chorobou v pozdějším stádiu je na počítačovém obrazu ještě méně barev (viz obrázek níže).

Transportér dopaminu (DAT) v normálním (A), časném Parkinsonově ’s (B) a pozdním stádiu Parkinsons ’ (C) mozku. Zdroj: Lancet


Co jsou to Lewyho těla?

Alfa-synuklein je protein nacházející se výhradně v neuronech. V PD se a-synuklein nachází v kuličkách známých jako Lewyho tělíska, která se nacházejí v neuronech.

Lewyho tělíska se nacházejí v dopaminergních neuronech v substantia nigra pars compacta a pravděpodobně přispívají ke smrti těchto neuronů. Lewyho těla se nacházejí v jiných oblastech mozku, jako je amygdala, locus coeruleus a jádro raphe.

Tyto oblasti mozku hrají roli v úzkosti a depresi. Oblast mozku zvaná kůra je zodpovědná za poznání a výkonné funkce, tj. Schopnost plánovat budoucnost. Předpokládá se, že Lewyho těla v této oblasti mozku způsobují demenci.


Jaké jsou příznaky?

Příznaky PD se liší od člověka k člověku, stejně jako rychlost progrese. Osoba, která má Parkinsonovu chorobu, se může setkat s některými z těchto běžnějších příznaků & quothallmark & ​​quot:

  • Bradykineze - pomalost pohybu, zhoršená obratnost, snížené mrkání, slintání, tvář bez výrazu.
  • Třes v klidu - nedobrovolné třesení, které klesá s účelným pohybem. Obvykle začíná na jedné straně těla, obvykle na ruce.
  • Tuhost - ztuhlost způsobená nedobrovolným zvýšením svalového tonusu.
  • Posturální nestabilita - pocit nerovnováhy. Pacienti to často kompenzují snížením těžiště, což má za následek skloněné držení těla.

Další příznaky, které se mohou nebo nemusí vyskytnout:

Zmrazení nebo uvíznutí na místě
Míchání chůze nebo přetažení jedné nohy
Sklopený postoj
Malý, stísněný rukopis
Problémy se spánkem, nespavost
Apatie, deprese
Snížená hlasitost nebo třes při mluvení
Obtížné polykání
Zácpa
Kognitivní porucha


Syntéza neuromelaninu: Mechanismy a význam

Na rozdíl od rozšířené distribuce jiných mozkových pigmentů, jako je lipofuscin, je neuromelanin omezen na oblasti mozku produkující katecholaminy a tvoří se pouze v neuronech. Neuromelanin se nejprve stane pozorovatelným v lidském SNpc přibližně ve věku 3 let a postupem času se hromadí v buňkách, ve kterých byl vytvořen, protože neurony zjevně postrádají mechanismy degradace nebo eliminace tohoto pigmentu. 25, 26 V důsledku toho se intracelulární neuromelanin s věkem hromadí, dokud nezabere většinu neuronální cytoplazmy. 25 Ačkoliv je stárnutí hlavním rizikovým faktorem pro rozvoj PD, 27 molekulární substrát spojující PD se stárnutím v současné době není znám.

Melaniny (z řeckého slova melanos [„Černá“]) je skupina komplexních, hnědočerně pigmentovaných biopolymerů, které zahrnují eumelanin (pigment spojený s tmavými vlasy a pokožkou), feomelanin (charakteristický pro červené a blond vlasy) a neuromelanin (tj. Mozkový melanin, který předpokládá se, že obsahuje jádro feomelaninu a povrch eumelaninu 28). Melaniny pocházejí ze složité biosyntetické dráhy iniciované hydroxylací L-tyrosinu na L-dihydroxyfenylalanin (1-dopa). Po tomto společném kroku slouží l -dopa jako prekurzor melaninů a katecholaminů, působících oddělenými cestami. Přestože syntéza periferních melaninových pigmentů (např. V kůži a vlasech) je poměrně dobře známa, mechanismus vedoucí k neuromelanogenezi je stále předmětem spekulací. Neuromelanin i periferní melaniny se produkují jako oxidační produkty po proudu od 1 -dopy. Ve skutečnosti je syntéza neuromelaninu považována za ochranný antioxidační mechanismus k odstranění potenciálně toxických oxidovaných druhů dopaminu, jako jsou chinony a semichinony, jejich přeměnou na neuromelanin. 29 Ačkoli je známo, že periferní melanogeneze probíhající ve specializovaných buňkách (tj. Melanocytech) je výsledkem enzymaticky řízené biosyntetické dráhy, ve které je tyrosinasa klíčovým, rychlost omezujícím enzymem, 30, široce se předpokládá, že neuromelanin je místo toho produkován spontánní neenzymatickou autooxidace dopaminu. 31 Několik postřehů je však proti posledně uvedenému konceptu. Distribuce neuromelaninu například zcela neodpovídá distribuci enzymu tyrosinhydroxylázy produkujícího dopamin (TH), u mnoha dopaminových a noradrenergních neuronů zcela chybí neuromelanin. 8, 32-34 Navíc neuromelanin není u většiny zvířecích druhů pozorován navzdory přítomnosti dopaminu a dalších katecholaminů u těchto zvířat. Ačkoli to může souviset s rozdíly v délce života nebo rychlosti syntézy katecholaminů mezi druhy, experimentálně indukované zvýšení dopaminu a/nebo oxidovaného dopaminu u myší a potkanů, dosažené buď chronickou léčbou l -dopou 35, 36, nebo geneticky zvýšením aktivity TH , 37 nejsou samy o sobě dostatečné k produkci neuromelaninu u těchto zvířat, jak by se dalo očekávat, pokud neuromelanin představuje pouhý proces autooxidovaného dopaminu. V této souvislosti je třeba poznamenat, že počáteční použití l -dopy George C. Cotziase u pacientů s PD bylo zjevně zaměřeno na obnovení hladin neuromelaninu, a nikoli dopaminu, protože si myslel, že PD může být důsledkem ztráty neuromelaninového pigmentu v SNpc. 38 Tento přístup však nedokázal obnovit chybějící pigment v mozcích PD (ale místo toho poskytl dramatický antiparkinsonický účinek nahrazením ochuzeného dopaminu, a tak zavedl novou revoluční léčbu PD, i když zřejmě ze špatného důvodu). 38

Identifikace specifických fází a změn v rychlosti produkce neuromelaninu v průběhu času u lidí 25, 26 naznačuje regulaci produkce a obratu neuromelaninu, případně prostřednictvím enzymatických procesů, 26 jako je tomu u všech ostatních melaninových pigmentů. 39 Je zajímavé, že exprese tyrosinázy nemusí být omezena na melanocyty, ale může být přítomna, i když na velmi nízkých úrovních, v mozku, včetně lidského SNpc. 40-43 Například exprese ribonukleové kyseliny messenger mozkové tyrosinázy ribonukleové kyseliny (mRNA) byla hlášena v lidském SN pomocí reverzní transkripční polymerázové řetězové reakce/polymerázové řetězové reakce v reálném čase, i když na stěží detekovatelných úrovních. 41-43 Podobně 3 různé mikročipové experimenty v lidské mozkové tkáni (Entrez_id: 7299 Allen Brain Institute Seattle, Washington), mozkové tkáni nelidského primáta (Entrez_id: 705792 National Institutes of Health [NIH] Blueprint Non-human Primate [NHP] Atlas) a vyvíjející se lidská prenatální tkáň (Entrez_id: 7299 BrainSpan Atlas vyvíjejícího se lidského mozku) detekovala přítomnost některých transkriptů tyrosinázy v mozku. V souladu s velmi nízkými hladinami, ve kterých by mohla být exprimována mRNA tyrosinázy, pokud vůbec, v mozku, nebyl skutečný protein detekován v lidském mozku při použití imunohistochemie nebo Western blotu. 44, 45 Podobně metody hmotnostní spektrometrie nedokázaly detekovat významná množství typických enzymů a proteinů zapojených do melanogeneze, včetně tyrosinázy, v izolovaných organelách obsahujících neuromelanin z lidských SN. 15, 46, 47 Naproti tomu enzymatická aktivita tyrosinázy byla hlášena v mozkových extraktech z lidského SN, 41 ačkoli 100 000krát nižší než v melanocytech. 48 Tyto nekonzistentní výsledky by mohly být potenciálně přičítány velmi nízkým hladinám, na kterých by tyrosinasa mohla být skutečně exprimována, pokud vůbec, v mozku, a proto jsou zaručeny další experimenty, které jednoznačně prokáží nebo vyvrátí existenci tyrosinázy v lidském mozku. Ačkoli v současné době není známo, zda tyrosináza může přispívat k syntéze neuromelaninu, je tato možnost teoreticky myslitelná, protože tyrosináza nejen zprostředkovává hydroxylaci tyrosinu a oxidaci l -dopy nezbytnou pro tvorbu periferních melaninů, ale je také schopná oxidovat katecholový kruh dopaminu , což je zásadní událost vyžadovaná pro syntézu neuromelaninu. 49 Kromě toho byla v nedávné době spojena vzácná mutace ztráty funkce tyrosinázy spojená s albinismem se zvýšeným rizikem PD, což bylo přičítáno možné neschopnosti této varianty tyrosinázy syntetizovat neuromelanin u těchto pacientů a následné akumulaci potenciálně toxických druhů odvozených od dopaminu, které nelze detoxikovat přeměnou na neuromelanin. 50 Na druhé straně, argumentujíc proti potenciální roli tyrosinázy při syntéze neuromelaninu, přítomnost neuromelaninu byla hlášena v mozku 2 subjektů s albinismem, 51 u kterých se obvykle předpokládá, že postrádají aktivitu tyrosinázy. Tato zpráva však byla publikována v pregenetické diagnostické éře a při absenci konkrétních informací o genetickém typu albinismu, kterým tyto případy trpí, nelze vyloučit, že u těchto subjektů byla ve skutečnosti přítomna reziduální aktivita tyrosinázy. 52 Kvůli klinickému překrývání subtypů okulokutánního albinismu (OCA) je molekulární diagnostika nezbytná pro stanovení defektu specifického genu, a tedy podtypu OCA. Mezi nejběžnějšími typy albinismu je ve skutečnosti způsoben mutacemi v genu pro tyrosinázu pouze podtyp OCA1. 53 U subjektů OCA1 je aktivita tyrosinázy zcela zrušena pouze v podtypu OCA1A, zatímco v OCA1B nějaká enzymatická aktivita stále zůstává, což umožňuje určitou akumulaci melaninového pigmentu v průběhu času. 53 V této souvislosti byl alespoň jednomu ze subjektů vyšetřovaných Foleyem a Baxterem diagnostikován „částečný albinismus“, 51 což naznačuje, že v těchto mozcích mohla být přítomna určitá zbytková aktivita tyrosinázy. Otevřenou otázkou proto zůstává, zda tyrosináza nebo jiné příbuzné enzymy mohou přispívat k syntéze neuromelaninu.


Materiály a metody

Zvířata

The Aphakia (ak) použitý kmen byl popsán dříve (Semina et al., 2000 Rieger et al., 2001). C57Bl/6-Jico byly použity jako kontrolní zvířata (Charles-River).

Chirurgická operace

Šest nebo sedmidenní myši C57Bl/6-Jico podstoupily operaci k odstranění očí. Myši byly anestetizovány 2% isofluranem (florane®) a N.2O (nosný plyn) a O2 (75: 65% objemu) a oční víčka byla ošetřena lidokainem jako lokálním anestetikem. Zvířata byla držena při 37 ° C s vyhřívací podložkou. Oční víčka byla otevřena nůžkami a membrána zakrývající oko byla odstraněna mikroháčkem. Oční bulva byla odstraněna proříznutím nervu a cévy skalpelem poté, co byly spojeny pomocí kleští. Oční víčka byla slepena dohromady tkáňovým lepidlem (Histoacryl® (Braun)) naneseným mikropipetou. Zvířata se zotavila z chirurgického zákroku a nezdálo se, že by byla tímto postupem ovlivněna.

Hybridizace in situ

Mozky dospělých zvířat a embrya E12.5 divokého a akmyši byly shromážděny a okamžitě zmrazeny na suchém ledu. Sagitální a koronální řezy (16 μm) byly naříznuty na kryostatu a shromážděny na podložní sklíčka SuperFrost Plus (Menzel Gläser). Hybridizace in situ se sondami značenými digoxigeninem (DIG) byla provedena v podstatě podle Schaeren-Wiemers a Gerfin-Moser (Schaeren-Wiemers a Gerfin-Moser, 1993). Stručně, řezy byly fixovány ve 4% paraformaldehydu (PFA) po dobu 10 minut a acetylovány 0,25% anhydridem kyseliny octové v 0,1 M triethanolaminu po dobu 10 minut. Hybridizace byla prováděna při 72 ° C v hybridizačním roztoku obsahujícím 50% deionizovaného formamidu, 5 × SSC, 5 × Denhardtův roztok, 250 μg/ml tRNA pekařské kvasinky a 500 μg/ml sonifikované DNA spermatu lososa. Posthybridizační promytí bylo prováděno v 0,2 x SSC po dobu 2 hodin při 72 ° C. DIG byl detekován pomocí protilátky značené alkalickou fosfatázou (Roche, Mannheim) s použitím NBT/BCIP jako substrátu. Po hybridizaci DIG in situ byla sklíčka dehydratována v ethanolu, vyčištěna v xylenu a připevněna pomocí Entellanu. Hybridizace DIG in situ byla provedena s následujícími sondami: a BalJá/EcoRI (bp 915-1137) fragment krysy ThcDNA (Grima a kol., 1985), an EcoRI/PstI fragment obsahující bp 1 až 285 krysy Pitx3 cDNA (Smidt et al., 1997), a Nurr1 cRNA obsahující bp 1022 až 3 'konec cDNA v plné délce (U72354), En1 fragment obsahující bp 1-1842 kompletní sekvence myší cDNA sekvence (L12703), an En2fragment (BglII/XbaI) obsahující bp 1351-2101 sekvence myší cDNA (L12705), a Lmx1b fragment (EcoRI) obsahující úplnou sekvenci myší cDNA, a Ret fragment obsahující bp 1733-1281 myší sekvence cDNA (X67812), transportér dopaminu (Dat) fragment (ApaJá/ZadníIII) obsahující bp 762-1127 potkaní cDNA sekvence (m80570), dekarboxylázu aromatické L-aminokyseliny (Aadc) fragment obsahující bp 22-488 kódující oblasti z myší cDNA, vezikulární monoaminový transportér 2 (Vmat2) fragment obsahující bp 290-799 kódující oblasti z myší cDNA, a Nli fragment obsahující bp 651-1778 myší cDNA (U69270), dopaminový receptor 2 (D2r) fragment obsahující bp 342-1263 kódující oblasti z myší cDNA, cholecystokinin (Cck) fragment obsahující úplnou cDNA potkana (nm_012829), neurotensinový receptor 1 (Ntr1) fragment obsahující bp 426-931 kódující oblasti z myší cDNA a alfa-synukleinový fragment obsahující bp 20-420 kódující oblasti z myší cDNA.

Kombinovaná in situ hybridizace-imunohistochemie

Řezy byly ošetřeny výše popsaným způsobem pro hybridizaci DIG, kromě toho, že po ukončení reakce alkalické fosfatázy byly řezy dvakrát promyty po dobu 5 minut v TBS. Poté byly inkubovány v 0,3%H2Ó2 v TBS po dobu 30 minut, aby se snížila aktivita endogenní peroxidázy, promyje se dvakrát 5 minut v TBS, zablokuje se 4% fetálním telecím sérem v TBS po dobu 30 minut, dvakrát se promyje 5 minut v TBS a inkubuje se přes noc při teplotě místnosti buď s anti Th (Pel-Freez, Arkansas, USA 1: 1000) v TBST (0,5 M Tris-HCl při pH 7,4, 9% NaCl, 0,5% Triton) nebo anti Pitx3 (1: 500) (Smidt et al., 2000) v TBST . Následující den byly řezy třikrát promyty TBS po dobu 5 minut, inkubovány po dobu 1 hodiny s biotinylovaným kozím anti-králičím imunoglobulinem v TBST (1: 1000), promyty třikrát TBS po dobu 5 minut, inkubovány po dobu 1 hodiny s avidinem biotin-peroxidázová činidla (souprava ABC elite, Vector Laboratories, 1: 1000) v TBST a promyta třikrát TBS po dobu 5 minut. Sklíčka byla obarvena DAB (3,3'-diaminobenzidinem), dokud nebylo pozadí lehce obarveno. Sklíčka byla dvakrát promyta demineralizovanou vodou po dobu 5 minut, dehydratována ethanolem a připevněna pomocí Entellanu.

Imunohistochemie

PFA (4%)-fixované vibratomové řezy byly použity pro přímou imunohistochemii, jak bylo popsáno dříve (Smidt et al., 2000). Imunohistochemie s řezy parafínovým voskem byla provedena, jak bylo popsáno dříve pro zmrazené řezy (Smidt et al., 2000) s následujícími modifikacemi. Řezy byly zbaveny parafínu prostřednictvím xylenu a rehydratovány řadou ethanolu. Řezy se vařily v 0,06 M citranu sodném (pH 6) po dobu 9 minut a poté se nechaly vychladnout na pokojovou teplotu. Byly použity následující protilátky: polyklonální králičí anti-Th (1: 1000 PelFreez) a polyklonální králičí anti-Pitx3 (1: 500) (Smidt et al., 2000).

Nisslovo barvení

Parafínem zalité koronální části středního mozku (7 μm) získané z dospělých divokých a ak myši byly upevněny na podložní sklíčka SuperFrost plus (Menzel Gläser). Sekce byly zbaveny parafinu, opláchnuty vodou, obarveny po dobu 10 minut v 0,5% kresylové violeti a krátce opláchnuty v acetátovém pufru, pH 4. Sekce byly poté diferencovány v 96% ethanolu po dobu 30 sekund, dehydratovány ve 100% ethanolu, čištěny v xylenu a namontován s Entellanem.

Retrográdní trasování Fluorogold

Pro injekce divokého typu a ak myši na následujících souřadnicích pro hřbetní striatum: (bregma = 0), 1,1 až přední, 1,5 laterální. Povrch lebky byl nastaven ve svislé poloze 0 a hloubka injekce byla 3 mm. Zvířata byla anestetizována 2,5 μl/g přípravku Hypnorm (5 minut po Hypnormová injekce. Během operace byl na oči myší divokého typu aplikován „CAF-zalf“ (Apharmo), aby se zabránilo vysychání očí. Tělesná teplota byla udržována na 37 ° C umístěním myší na topné podložky. Retrográdní tracer Fluorogold (Fluorochrome, USA) byl iontoforeticky dodán skleněnou mikropipetou (vnitřní průměr 10-15 μm) naplněnou 2% Fluorogold v 0,1 M kakodylátovém pufru (pH 7,3). Tracer byl aplikován pomocí přesného proudového zdroje midgard 51413 [polarita -, 5 μA po dobu 10 minut (nastavení pulsu 7 sekund zapnuto, 7 sekund vypnuto) červené pero (+) do ucha myší, černé pero ( -) v Fluorogoldův roztok]. Skleněné kapiláry (1,5 mm OD, 0,86 mm ID, borosilikátové sklo, standardní stěna s vnitřním vláknem, elektromedické přístroje Clark, Reading, Velká Británie) byly připraveny na mikropipetovém stahováku (Getra, Munchen, Německo) s následujícím nastavením: Ohřev: 7.5-8, Magnet: 3. Zvířata byla usmrcena 48 hodin po infuzích a mozky byly izolovány a fixovány po dobu 24 hodin ve 4% PFA (čerstvém) při 4 ° C. Řezy (50 μm) byly rozřezány vibratomem (Leica) a vyšetřeny pod fluorescenčním mikroskopem nebo použity pro další imunohistochemické experimenty.

Horolezecký test

Test byl proveden podle popisu (Costall et al., 1978a Costall et al., 1978b) kromě toho, že lezení bylo hodnoceno každých 5 minut po dobu 90 minut (0 = všechny tlapky na podlaze, 1 = 2 tlapky na kleci, 2 = všechny tlapky na kleci). Žádnému ze zvířat nebyla injekčně podána droga.

Středně otevřený test

Otevřené pole se skládalo z otevřeného válce z plexiskla (průměr 20 cm, výška 30 cm) umístěného na bílé plastové desce. Pohybová aktivita byla monitorována po dobu 15 minut pomocí plně automatizovaného pozorovacího systému (1,6 snímků za sekundu, Ethovision, Noldus Information Technology, Nizozemsko). Zvířata byla použita ve věku 3 měsíců. Experiment byl prováděn za normálních světelných podmínek mezi 10 a 15 hodinou.

Automatizovaná kvantitativní analýza chůze

Chůze divokého typu a ak myši byly analyzovány, jak bylo popsáno dříve (Hamers et al., 2001).


MATERIÁLY A METODY

Zvířata

Experimenty byly prováděny v Pitx3-neficientní myši ze dvou různých chovných strategií. Dospělé myši C57Bl/6-Jico divokého typu (Charles River Laboratories, Francie) a myši Aphakia (ak), které již byly popsány dříve (Semina et al., 2000 Rieger et al., 2001 Smidt et al., 2004a) byly používá se v homozygotním chovu. V heterozygotním chovu byli samci ak myší kříženi se samicemi myší C57BL/6-Jola za vzniku heterozygotních hybridů F1. Pro generování byly kříženy F1 hybridy Pitx3 +/+ , Pitx3 +/- a Pitx3 -/ - potomstvo. Genotypy byly určeny pomocí PCR analýzy ocasní DNA. Těhotné myši byly dekapitovány nebo usmrceny CO2 zadušení a embrya byla odebrána v E13.5, E14.5 nebo E18.5 (den, kdy byla detekována kopulační zátka, byl považován za E0). Dospělé myši byly usmrceny CO2 bylo odebráno zadušení a mozek. Myši byly chovány v naší laboratoři za standardních podmínek (21,0 ± 1,0 ° C a 50% vlhkost) s ad libitum přístupem ke standardním potravinám (Hope Farms) a vodě z vodovodu v cyklu 12:12 hodin světlo: tma. Všechny experimentální postupy byly schváleny etickou komisí pro experimenty na zvířatech Utrechtské univerzity v Nizozemsku.

Hybridizace in situ

Embrya a mozky dospělých byly odebrány a okamžitě zmrazeny na suchém ledu. Řezy (16 μm) byly nařezány a shromážděny na podložní sklíčka SuperFrost Plus (Menzel Gläser). Hybridizace in situ (ISH) s cRNA značenými digoxigeninem (DIG) a [33 P] značenými cRNA byla provedena, jak bylo popsáno dříve (Smidt et al., 2004a Smits et al., 2005). [33 P] označené úseky byly dehydratované, sušené na vzduchu a vystavené zobrazovacím deskám BAS-MS 2340 (Fuji) po dobu 3–5 dnů nebo filmům Kodak Biomax MR (Kodak) po dobu 3 týdnů. Autoradiografické zobrazovací destičky BAS-MS 2340 obsahující hybridizační signály byly skenovány pomocí zobrazovacího systému FLA-5000 (Fuji) a kvantitativní analýza byla provedena pomocí softwaru AIDA Image Analyzer Software (Raytest). Genová exprese byla analyzována v levém i pravém SNc (Pitx3 +/ +: n=8 Pitx3 +/- : n= 5). Na zvíře byly analyzovány dvě sousední sekce v SNc. K vyhodnocení statistické významnosti byla data podrobena Studentově t-test (dvouocasý). Byly použity následující sondy: 1142 bp fragment krysy Th cDNA (Grima a kol., 1985), an Aadc (také známý jako Ddc -Mouse Genome Informatics) fragment obsahující bp 22-488 myší kódující sekvence (Smits et al., 2003), fragment obsahující bp 290-799 kódující oblasti z myši Vmat2 (také známý jako Slc18a2 -Mouse Genome Informatics) gen (Smits et al., 2003), alfa-synuklein (a-synuklein Snca) fragment containing bp 20-420 of the coding region from the mouse cDNA(Smidt et al., 2004a), and an Ahd2 fragment containing bp 568-1392 of the mouse coding sequence.

Immunohistochemistry

Embryos and adult brains were collected, incubated overnight in 4%paraformaldehyde (PFA) at 4°C, and embedded in paraffin. Sections (7μm) were cut on a microtome, collected on SuperFrost Plus slides (Menzel Gläser), de-paraffinated through xylene, rehydrated through an ethanol series and incubated in 0.3% H2Ó2 in Tris-buffered saline (TBS) for 30 minutes. Next, sections were boiled in citrate buffer (pH 6) for antigen retrieval, blocked with 4% fetal calf serum in TBS for 30 minutes and incubated overnight with rabbit anti-TH antibody (Pel-Freez,Arkansas, USA 1:1000) in TBS/0.5% Triton at 4°C. The next day, sections were incubated for 1 hour with biotinylated goat anti-rabbit immunoglobulin in TBS (1:1000), followed by incubation with avidin-biotin-peroxidase reagents(ABC elite kit, Vector Laboratories, 1:1000) for 1 hour in TBS. The slides were stained with DAB (3,3′-diamino-benzidine) for a maximum of 10 minutes, until the background was lightly stained. Slides were dehydrated with ethanol and mounted using Entellan. Quantification of neurons was performed using a microscope (Zeiss Axiovert 405M) attached to a camera system(MicroPublisher 5.0 RTV) and imaging software (Openlab 5.0.1, Improvision). The number of TH-immunoreactive (TH-IR) neurons was counted unilaterally in anatomically matched adjacent coronal sections. For each E14.5 embryo, four sections were counted in the caudal and rostral domain of the mdDA system. For each E18.5 embryo, sections containing the SNc were analyzed (27-40 sections)and the average number of TH-IR neurons per section was calculated. Only neurons in which cell nuclei could be recognized were counted. Quantification was performed by an independent observer in a blind design. To evaluate statistical significance, data were subjected to the Student's t-test(two tailed).

For double-immunofluorescence staining, sections were incubated overnight with rabbit anti-Ahd2 (Abcam, diluted 1:100) in combination with sheep anti-TH(Chemicon, diluted 1:500) in PBS/0.5% Triton at 4°C. The next day,sections were incubated with fluorophore-conjugated secondary antibodies in PBS (Alexa-Fluor-488-conjugated goat anti-rabbit and Alexa-Fluor-555-conjugated donkey anti-sheep, diluted 1:400 Molecular Probes)for 1 hour at room temperature and embedded with 90% glycerol.

Nissl staining

TH-IR sections were counterstained for 5 minutes in 0.5% cresyl violet and briefly rinsed in an acetate buffer (pH 4). The sections were then differentiated in 96% ethanol for 60 seconds, dehydrated in 100% ethanol,cleared in xylene and mounted with Entellan. Neuronal number per section in the rostral mdDA area was determined in cresyl violet-stained sections,delineated according to TH-IR area. Quantification (n=3) was performed by an independent observer in a blind design. To evaluate statistical significance, data were subjected to the Student's t-test(two tailed).

Combined ISH-immunohistochemistry

Adult brains were collected, incubated overnight in 4% PFA at 4°C, and embedded in paraffin. Sections (7 μm) were cut and collected on SuperFrost Plus slides (Menzel Gläser). ISH on paraffin wax sections was performed as described for frozen sections with the following modifications: sections were first deparaffinated through xylene, rehydrated through an ethanol series, boiled in citrate buffer (pH 6), and incubated in 0.2 M HCl for 15 minutes. Sections were further treated as described above for DIG-ISH on frozen sections, except that, after termination of the alkaline phosphatase reaction, sections were immunostained for TH with the avidin-biotin-peroxidase complex (ABC) method, as described above.

RNA isolation, PCR and cloning

RNA from E18 mouse whole brain or MN9D cells was isolated using Trizol(Invitrogen) according the manufacturer's guidelines. A sample of Pitx3 +/GFP FACS-sorted mdDA cells from E16 embryos was isolated via the guanidine thiocyanate method.

Full-length Pitx3 cDNA was amplified from cDNA originating from E18 whole-brain RNA, with the following primers: forward,5′-CCCTGCCTGCGCTCCAGAAC-3′ reversed:5′-CCCTGTTCCTGGCCTTAGTC-3′. Pitx3 was ligated in pGEM-T easy vector (Promega) for sequence analysis, and subsequently cloned into pcDNA3.1(-) vector (Invitrogen) using the ApaJá a BstxI restriction sites.

To distinguish between the Ahd2 a Aldh1a7 genes,primers with 100% homology to both genes were designed: forward,5′-GACTGATGAGATGCGCATTG-3′ reversed 5′-GTCTTGAGCTCAGTGTATTC-3′. For in vivo determination, RNA originating from E16 ventral midbrain Pitx3 +/GFP cells was subjected to OneStep reverse transcriptase (RT)-PCR (Qiagen). For in vitro determination, RNA from MN9D cells transfected with Pitx3-pcDNA3.1 was used. The obtained PCR fragments were cloned into pGEM-T easy vectors and eight different clones of each cloning were sequence-analyzed (Baseclear, The Netherlands).

MN9D cell culture and cell transfections

MN9D (MN9D-13N) cells were cultured in Dulbecco's Modified Eagle Medium(DMEM) supplemented with 10% (v/v) hiFCS, 100 units/ml penicillin, 100 units/ml streptomycin and 2 mM L-glutamine in a humidified atmosphere with 5%CO2 at 37°C. Cells were grown on 10-cm-diameter dishes coated with poly L-lysine. At 2 hours prior to transfection, culture medium was replaced with medium without antibiotics, and transfection was performed using Lipofectamine 2000 (Invitrogen), according to the manufacturer's guidelines. Cells were transfected with 5 μg of Pitx3-pcDNA3.1 or an equal molar amount of empty pcDNA3.1 vector together with carrier DNA and 1 μg of EGFP-N1 vector (Clontech). At 6 hours after transfection, cells were divided and allowed to grow for an additional 30 hours. Transfection efficiency was determined based on GFP fluorescence using a fluorescent microscope, and plates were matched based on their relative transfection efficiency. For MN9D cells, a typical transfection efficiency with Lipofectamine is approximately 80-90%. Finally, cells were harvested for RNA isolation or used for a chromatin immunoprecipitation assay.

Semi-quantitative RT-PCR

Relative gene expression levels were determined using a OneStep RT-PCR kit(Qiagen). We used 50 ng total RNA per reaction, and for each transcript the linear phase was determined and reactions were stopped during that phase for analysis (for primer sequences, see Table 1). Samples were loaded on 2% agarose gels and, after gel electroforesis, gels were scanned using a FLA-5000 imaging system (Fuji) and relative amounts of DNA were measured with a densitometer. Each analysis was replicated at least three times with independent RNA samples to confirm the obtained results. To determine whether RA regulates the expression of TH, we cultured MN9D cells in the presence of 1 μM all-trans RA for 36 hours as described previously (Castro et al.,2001).

Primer sequences for semi-quantitative RT-PCR analysis

Fragments . Forward primer (5′→3′) . Reversed primer (5′→3′) .
OneStep RT-PCR (Fig. 5)
AADCGAAGAGGCAAGGAGATGGTG AACTTTAGTCCGAGCAGCCA
Ahd2AGGCTGGGCTGACAAGATTC AAGGCCACCTTGTCGACATC
Pitx3CCCTCCGCTTCCAGAACATG GTCCACACCGCGATCTCTTC
SncaACTTTCAAAGGCCAAGGAGG AGGCTTCACGCTCATAGTCTTG
TbpGAGAATAAGAGAGCCACGGAC′ TCACATCACAGCTCCCCAC
THCCCACGTGGAATACACAAAG′ GAGGCATGACGGATGTACTG
Vmat2GCAGTCACACAAGGCTACCA TGAATAGCCCCATCCAAGAG
ChIP-assay (Fig. 6)
Region 1 ACCCTGTTGTATCACGTATG CAGTGTGGACTAAAAGCTAG
Region 2 CAGCCAAGTTCCAGGAGATG GTATCTGATACAACCTGGGC
Region 3 GGAGGCAATCATGTAACTATC′ GGGGACCTCAGTAAAGAATC
Region 4 AGGGAGCATGCAAATGAAAG AGCACCAAACAGATCCATTC
Region 5 CATCTGCTCTAGTCAGTAAG ACAGGCATAGAGAAGGCTTC
Region 6 GAGGTAGCTGCTTAACTTAC CCCAGGTAGTATCTTTCTTAC
Region 7 CTGTCCCCTAAATTGACAA ATAGCCACTCTTCCTATAAC
Region 8 GGAAAGGATGTCATATAGTC GCTCCAGAGGCTACTTCAG
Region 9 CCCTTGGACACACAGTTGTC CAATGGCTCCCTTCTCTAATC
Fragments . Forward primer (5′→3′) . Reversed primer (5′→3′) .
OneStep RT-PCR (Fig. 5)
AADCGAAGAGGCAAGGAGATGGTG AACTTTAGTCCGAGCAGCCA
Ahd2AGGCTGGGCTGACAAGATTC AAGGCCACCTTGTCGACATC
Pitx3CCCTCCGCTTCCAGAACATG GTCCACACCGCGATCTCTTC
SncaACTTTCAAAGGCCAAGGAGG AGGCTTCACGCTCATAGTCTTG
TbpGAGAATAAGAGAGCCACGGAC′ TCACATCACAGCTCCCCAC
THCCCACGTGGAATACACAAAG′ GAGGCATGACGGATGTACTG
Vmat2GCAGTCACACAAGGCTACCA TGAATAGCCCCATCCAAGAG
ChIP-assay (Fig. 6)
Region 1 ACCCTGTTGTATCACGTATG CAGTGTGGACTAAAAGCTAG
Region 2 CAGCCAAGTTCCAGGAGATG GTATCTGATACAACCTGGGC
Region 3 GGAGGCAATCATGTAACTATC′ GGGGACCTCAGTAAAGAATC
Region 4 AGGGAGCATGCAAATGAAAG AGCACCAAACAGATCCATTC
Region 5 CATCTGCTCTAGTCAGTAAG ACAGGCATAGAGAAGGCTTC
Region 6 GAGGTAGCTGCTTAACTTAC CCCAGGTAGTATCTTTCTTAC
Region 7 CTGTCCCCTAAATTGACAA ATAGCCACTCTTCCTATAAC
Region 8 GGAAAGGATGTCATATAGTC GCTCCAGAGGCTACTTCAG
Region 9 CCCTTGGACACACAGTTGTC CAATGGCTCCCTTCTCTAATC

Chromatin immunoprecipitation (ChIP) assay

MN9D cells were transfected with Pitx3-pcDNA3.1 or empty pcDNA3.1 expression vector at 90% confluence. At 6 hours after transfection, cells were divided and allowed to grow for an additional 30 hours. Formaldehyde was added directly to the medium to a final concentration of 1%, and cells were incubated at room temperature for 10 minutes. Glycine was added to a final concentration of 0.125 M, and cells were incubated at room temperature for an additional 5 minutes. Cells were washed twice with PBS, harvested and pelleted by centrifugation. ChIP was performed as described previously(Matthews et al., 2005), with some adjustments. Cells were resuspended in lysis buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate]containing protease inhibitors (Complete Protease Inhibitor Cocktail Tablets,Roche) and were incubated on ice for 20 minutes. Subsequently, the lysate was put through a 27/3-4 G syringe three times. Chromatin was sonicated using a Soniprep 150 sonicator to obtain DNA of an average length of 400-500 bp. Chromatin was pre-cleared with 60 μl of a 50% slurry of Protein A agarose/Salmon Sperm DNA (Upstate) for 1.5 hours at 4°C. Pre-cleared chromatin was incubated overnight with approximately 1 μg of Pitx3 antibody(Smidt et al., 2000), or with 1 μg of rabbit whole serum immunoglobulins (Sigma) as a negative control. Antibody-DNA complexes were captured by adding 20 μl of a 50% slurry of Protein A agarose/Salmon Sperm DNA for 1 hour at 4°C. Immunoprecipitated complexes were washed for 10 minutes with the following wash buffers: twice with 1.5 ml of buffer 1 [20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM EDTA, 1%Triton X-100, 0.1% sodium dodecyl sulfate (SDS)], once with 1.5 ml of buffer 2[20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS],once with 1.5 ml of LiCl buffer [20 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate], and twice with 1.5 ml of TE [10 mM Tris-HCl (pH 8.0), 1 mM EDTA]. For elution of the immunocomplexes, 150 μl of elution buffer (TE, 1% SDS) was added and beads were shaken on a vortex for 30 minutes at 4°C. This was performed twice and samples were pooled. Crosslinks were reversed overnight at 67°C and complexes were precipitated and dissolved in TE. Proteinase K was added and samples were incubated for 2 hours at 45°C. Samples were extracted once with phenol/chloroform (1:1)and twice with chloroform. DNA was precipitated and dissolved in 100 μl of PCR grade MilliQ. For each PCR reaction, 2 μl of this DNA sample was used(for primer sequences, see Table 1).

Retinoic acid treatment of pregnant Pitx3 +/- myši

Following timed matings of Pitx3 +/- parents, pregnant mice were supplemented with all-trans-RA (Sigma), which will be referred to as RA in this article, twice daily from E10.75 to E13.75. RA was dissolved in corn-oil and mixed with powdered food to a final concentration of 0.25 mg/g food, which was supplied ad libitum as previously described(Niederreither et al., 2002c Mic et al., 2003). RA was dissolved freshly each time and supplemented food was supplied at 12-hour intervals. The control Pitx3 +/- animals were treated according to the same protocol, but were supplemented with corn oil without RA. Embryos were isolated at E14.5 and E18.5, and weight-matched Pitx3 +/+ and Pitx3 -/- littermates were analyzed by immunohistochemistry.


Why do neurons die in Parkinson's disease? Study of hereditary Parkinson&rsquos finds that mitochondria can&rsquot be cleared out when damaged

Current thinking about Parkinson's disease is that it's a disorder of mitochondria, the energy-producing organelles inside cells, causing neurons in the brain's substantia nigra to die or become impaired. A study from Children's Hospital Boston now shows that genetic mutations causing a hereditary form of Parkinson's disease cause mitochondria to run amok inside the cell, leaving the cell without a brake to stop them.

Findings appear in the Nov. 11 issue of Buňka.

Mitochondrial movement is often a good thing, especially in neurons, which need to get mitochondria to cells' periphery in order to fuel the axons and dendrites that send and receive signals. Nicméně, arresting this movement is equally important, says senior investigator Thomas Schwarz, PhD, of Children's F.M. Kirby Neurobiology Center, since it allows mitochondria to be quarantined and destroyed when they go bad.

"Mitochondria, when damaged, produce reactive oxygen species that are highly destructive, and can fuse with healthy mitochondria and contaminate them, too," Schwarz says. "It's the equivalent of an environmental disaster in the cell."

Studying neurons from fruit flies, rats and mice, as well as cultured human cells, Schwarz and colleagues provide the most detailed understanding to date of the effects of the gene mutations, which encode the proteins Parkin and PINK1. They demonstrate how these proteins interact with proteins responsible for mitochondrial movement -- in particular Miro, which literally hitches a molecular motor onto the organelle.

Normally, when mitochondria go bad, PINK1 tags Miro to be destroyed by Parkin and enzymes in the cell, the researchers showed. When Miro is destroyed, the motor detaches from the mitochondrion. The organelle, unable to move, can then be disposed of: The cell literally digests it.

But when either PINK1 or Parkin is mutated, this containment system fails, leaving the damaged mitochondria free to move about the cell, spewing toxic compounds and fusing to otherwise healthy mitochondria and introducing damaged components.

The study's findings are consistent with observed changes in mitochondrial distribution, transport and dynamics in other neurodegenerative diseases such as Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (Lou Gehrig's disease), and Charcot-Marie-Tooth disease, the researchers note.

Although the team studied a rare hereditary form of Parkinson's, the findings may shed light on what's going on in the more common sporadic form of the disease, Schwarz says.

"Whether it's clearing out damaged mitochondria, or preventing mitochondrial damage, the common thread is that there's too much damage in mitochondria in a particular brain region," he says.

While Schwarz sees potential in gene therapy to restore normal PINK1 or Parkin to neurons, he is more interested in the possibility of helping neurons flush out bad mitochondria or make enough new, healthy mitochondria to keep them viable. "We may need to do both," he says.


To what extent does loss of neurons in the substantia nigra affect movement? - Biologie

Neuroscience Online is an open-access electronic resource for students, faculty, and those interested in neuroscience. The project began in 1999 and the first section, Buněčná a molekulární neurobiologie, was released in 2007.

Development continues with new features, such as mobile-friendly functionality, course lecture videos, clinical correlate lecture videos and in 2015, we launched Neuroanatomy Online, an open-access electronic laboratory to complement Neuroscience Online as a resource for the study of neuroanatomy.

Neuroscience Online a Neuroanatomy Online need your support. Donations to our site will support further development of new content, animations, videos and self-test examination questions. We want to continue to provide this valuable resource, free of advertisement, fees and without limitations.

Follow the link to make a donation: Neuroscience Online Giving

Video of Clinical Correlate Lecture on Friedreich's Ataxia

The previous motor system chapters have deconstructed the motor system into its component parts, in an effort to portray how the brain’s “divide and conquer” strategy assigns different motor control tasks to different brain regions. This chapter describes the types of disorders that result from damage or disease to different parts of the motor system. In the process, the different components of the motor system are reviewed to see how they work together to produce the fluid, effortless body movements that we take for granted. An emphasis is placed on trying to explain the causes and symptoms of motor system disorders in terms of the basic principles of neuroanatomy and neuronal function that you learned in the earlier chapters.

6.1 Lower Motor Neuron Syndrome

The first level of the motor system hierarchy is the spinal cord, the location of the alpha motor neurons that constitute the “final common pathway” of all motor commands. Alpha motor neurons directly innervate skeletal muscle, causing the contractions that produce all movements. Reflex circuits and other circuitry within the spinal cord underlie the automatic processing of many of the direct commands to the muscles (the “nuts and bolts” processing), thereby freeing higher-order areas to concentrate on more global, task-related processing.

Motor system dysfunction can result from damage or disease at any level of the motor system hierarchy and side-loops. Differences in the symptoms that result from damage at different levels allow the clinician to localize where in the hierarchy the damage is likely to be. Poškození alpha motor neurons results in a characteristic set of symptoms called the lower motor neuron syndrome (lower motor neurons refer to alpha motor neurons in the spinal cord and brain stem all motor system neurons higher in the hierarchy are referred to as upper motor neurons). This damage usually arises from certain diseases that selectively affect alpha motor neurons (such as polio) or from localized lesions near the spinal cord. Lower motor neuron syndrome is characterized by the following symptoms:

Figure 6.1
Fasciculations and fibrillations. Click on buttons to see demonstration.

6.2 Upper Motor Neuron Syndrome

Damage to any part of the motor system hierarchy above the level of alpha motor neurons (not including the side loops) results in a set of symptoms termed the upper motor neuron syndrome. Some of these symptoms are opposite of those of lower motor neuron disorders. Thus, one of the critical determinations a clinician must make is whether a patient presenting with motor problems has an upper motor neuron disorder or a lower motor neuron disorder.

Upper motor neuron disorders typically arise from such causes as stroke, tumors, and blunt trauma. For example, strokes to the middle cerebral artery, lateral striate artery, or the medial striate artery can cause damage to the lateral surface of cortex or to the internal capsule, where the descending axons of the corticospinal tract collect. The symptoms of upper motor neuron syndrome are:

In addition to the above symptoms, damage to the motor cortex and association cortex can result in impairments in motor planning and strategies and in an inability to perform complex motor tasks. Performance of simple tasks is intact, but patients are unable to perform complex, practiced tasks. This symptom is known as apraxia. For example, patients may be unable to arrange a set of blocks to match an example block-structure in front of them. They can move the blocks individually, but cannot come up with a motor plan to arrange them properly. This disorder is known as constructional apraxia. Other apraxias include dressing apraxia (inability to dress oneself) and verbal apraxia (inability to coordinate mouth movements to produce speech).

A section or crush of the spinal cord will result in paralysis of all parts of the body below the damaged region. Even though such an injury occurs in the spinal cord, it is not considered a lower motor neuron disorder, as the alpha motor neurons themselves are not directly damaged. If the damage occurs at the cervical level, then all four limbs will be paralyzed (quadriplegia). If the damage occurs below the cervical enlargement, then only the legs are paralyzed (paraplegie). Other terms used to describe patterns of paralysis are hemiplegia (paralysis to one side of the body) and monoplegia (paralysis of a single limb).

6.3 Disorders of the Basal Ganglia

The bazální ganglia have historically been considered part of the motor system because of the variety of motor deficits that occur when they are damaged. The types of symptoms that result from basal ganglia disorders can be divided into two classes: dyskinesias, which are abnormal, involuntary movements, and akinesias, which are abnormal, involuntary postures. Because the basal ganglia were once considered to form a separate, “extrapyramidal” motor system, these symptoms are called extrapyramidal poruchy.

  1. Resting tremors are most often associated with Parkinson’s disease. When the patient is at rest, certain body parts will display a 4-7 Hz tremor. For example, the thumb and forefingers will move back-and-forth against each other in a characteristic tremor called “pill-rolling tremor.” The tremor stops when the body part engages in active movement.
  2. Athetosis is characterized by involuntary, writhing movements, especially of the hands and face.
  3. Chorea , which derives from the Greek word for “dance,” is characterized by continuous, writhing movements of the entire body. It is viewed by some as an extreme form of athetosis. Chorea is most closely identified with Huntington’s disease.
  4. Ballismus is characterized by involuntary, ballistic movements of the extremities.
  5. Tardive dyskinesia can result from the long-term use of antipsychotic drugs that target the dopamine system. It is characterized by involuntary movements of the tongue, face, arms, lips, and other body parts. It is thought to occur as the result of an imbalance between the D1 and D2 receptors, thereby favoring the direct pathway over the indirect pathway.
  1. Rigidity is a resistance to passive movement of the limb. Unlike spasticity, rigidity does not depend on the speed of the passive movement. In some patients, this resistance is so great that it is referred to as lead-pipe rigidity, because moving the patient’s limb feels like bending a lead pipe. In some patients, this rigidity is coupled with tremors and is called cogwheel rigidity, as moving the limb feels to the clinician like the catching and release of gears. As with spasticity, the mechanism is not entirely understood, but may result from continuous firing of alpha motor neurons causing a continual contraction of the muscle.
  2. Dystonia is the involuntary adoption of abnormal postures, as agonist and antagonist muscles both contract and become so rigid that the patient cannot maintain normal posture.
  3. Bradykinesia refers to a slowness, or poverty, of movement.

A number of well-known movement disorders are associated with basal ganglia dysfunction. We shall concentrate on 3 of the most well-understood: Parkinson’s disease, Huntington’s disease, and hemiballismus. To understand how these disorders result in the specific symptoms, it is necessary to review the circuit anatomy of the basal ganglia that was presented in the Basal Ganglia chapter.

Parkinson’s disease results from the death of dopaminergic neurons in the substantia nigra pars compacta. It is characterized by a resting tremor, but the most debilitating symptom is severe bradykinesia or akinesia. In advanced cases, patients have difficulty initiating movements, although involuntary, reflexive movements can be normal. It is as if the loss of the substantia nigra neurons has put a brake on the output of motor cortex, inhibiting voluntary motor commands from descending to the brain stem and spinal cord.

Although the cause of Parkinson’s disease is still not known, much has been learned in the past 15 years from the development of an animal model of Parkinson’s disease. This model was discovered by accident when a number of young patients presented with symptoms remarkably similar to Parkinson’s disease. These patients were drug addicts who had been taking an artificially manufactured drug called MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyradine). This drug destroyed the dopaminergic neurons in the substantia nigra, leading to a Parkinsonian disorder. Laboratory animals injected with MPTP have since become a leading model for understanding the disease and developing treatments.

How does the loss of the dopaminergic neurons cause the poverty of movements associated with Parkinson’s disease (Figure 6.3)? Recall from the Basal Ganglia chapter that the substantia nigra pars compacta projects to both direct pathway and indirect pathways neurons in the striatum. Because there are two different types of dopamine receptors, substantia nigra activity excites the direct pathway and inhibits the indirect pathway. The net effect of the direct pathway is to excite motor cortex, and the net effect of the indirect pathway is to inhibit motor cortex. Thus, the loss of the nigrostriatal dopaminergic pathway upsets the fine balance of excitation and inhibition in the basal ganglia and reduces the excitation of motor cortex. In ways that are not understood, this reduction of thalamic excitation interferes with the ability of the motor cortex to generate commands for voluntary movement, resulting in the poverty of movement of Parkinsonian patients. It is as if all of the motor programs stored in cortex are constantly inhibited by the indirect pathway, with not enough excitation of the direct pathway for the desired motor program to become activated.

Figure 6.3
Parkinson’s disease results from degeneration of the nigrostriatal pathway. Three therapeutic interventions are L-Dopa therapy, pallidotomy, and deep brain stimulation.

There is no cure for Parkinson’s disease, but a number of effective treatments exist. The earliest effective treatment was developed when it was first discovered that Parkinson’s disease was caused by a loss of dopaminergic neurons. Because dopamine itself does not cross the blood-brain barrier, L-Dopa, a chemical precursor to dopamine, was used to replenish the supply of dopamine. Amazingly, flooding the system with L-Dopa resulted in profound improvements in the symptoms of patients. Unfortunately, this improvement is temporary, and typically symptoms return after a number of years. Surgical intervention, such as making lesions to the globus pallidus internal segment (pallidotomy), has shown effectiveness in some patients. In recent years, a new therapy, deep brain stimulation of the subthalamic nucleus, has been gaining in popularity. In this treatment, an electrical stimulator is implanted in the subthalamic nucleus. When the electrical current is turned on to stimulate the nucleus, the patient’s symptoms disappear immediately. It is not known why this procedure works, or what its long-term efficacy is. Because the projection from the subthalamic nucleus is excitatory onto globus pallidus neurons, which inhibit the thalamus, it is paradoxical that such stimulation should increase motor cortex activity. One thought is that the stimulation might actually overload the subthalamic nucleus, thereby inhibiting it and disinhibiting the thalamus.

Huntington’s disease (také známý jako Woody Guthrie Disease) is a genetic disorder that is caused by an abnormally large number of repeats of the nucleotide sequence CAG on chromosome 4. Normal individuals have 9-35 repeats of this sequence mutations that cause larger repeats give rise to Huntington’s disease. It is an autosomal dominant mutation, such that the offspring of a patient with Huntington’s disease has a 50% chance of inheriting the mutation. Individuals with the mutated gene will invariably develop Huntington’s disease, usually near middle age. The affected gene codes for a protein known as huntingtin, the function of which is not known. The effect of the mutated version of the gene, however, is to kill the indirect pathway neurons in the striatum, particularly those of the caudate nucleus.

Huntington’s disease is also known as Huntington’s chorea because it is characterized by a continuous, choreiform movements of the body (especially the limbs and face). In addition, the disease in advanced stages is associated with dementia. There is at present no cure or effective treatment for Huntington’s disease.

Why does the loss of indirect pathway neurons in the striatum cause the dyskinesias of Huntington’s disease (Figure 6.4)? Recall that the net effect of the indirect pathway is to inhibit motor cortex. With the loss of these neurons, the excitatory effect of the direct pathway is no longer kept in check by the inhibition of the indirect pathway. Thus, the motor cortex gets too much excitatory input from the thalamus, disrupting its normal functioning and sending involuntary movement commands to the brain stem and spinal cord. Because inappropriate motor programs are not inhibited normally, the cortex continuously sends involuntary commands for movements and movement sequences to the muscles.

Figure 6.4
Huntington’s disease results from degeneration of the indirect pathways cells of the striatum.

Hemiballismus results from a unilateral lesion to the subthalamic nucleus, usually caused by a stroke. This lesion results in ballismus on the contralateral side of the body, while the ipsilateral side is normal (hence the term hemiballismus). The involuntary, ballistic movements result from the loss of the excitatory subthalamic nucleus projection to the globus pallidus (Figure 6.5). Because the globus pallidus internal segment normally inhibits the thalamus when excited, the loss of the subthalamic component lessens the inhibition of the thalamus, making it more likely to send spurious excitation to the motor cortex. Some surgical operations have been performed to relieve the symptoms of hemiballismus, and new pharmacological treatments are in use to relieve the disorder.

Figure 6.5
Hemiballismus results from unilateral damage to the subthalamic nucleus.

6.4 Disorders of the Cerebellum

Like the basal ganglia, the mozeček has historically been considered part of the motor system because damage to it produces motor disturbances. Unlike the basal ganglia, damage to the cerebellum does not result in lack of movement or poverty of movement. Instead, cerebellar dysfunction is characterized by a lack of movement coordination. Also unlike basal ganglia (and motor cortex), damage to the cerebellum causes impairments on the ipsilateral side of the body.

Figure 6.6
Dysdiadochokinesia. A normal subject can easily perform rhythmic movements like rapidly pronating and supinating the hands and forearms (click NORMAL). A patient with a cerebellum lesion cannot perform this task

Figure 6.7
Intention tremor. A normal subject can make a directed movement to a target (click NORMAL). A patient with a cerebellum lesion displays an intention tremor, in which the movement starts smoothly toward the target but then oscillates back and forth until the hand slowly contacts the target (click ABNORMAL).

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side. This answer is INCORRECT.

An exaggerated stretch reflex is an upper motor neuron symptom.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side. This answer is INCORRECT.

Cerebellar lesions do not produce paralysis.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side. This answer is INCORRECT.

Lesions of the posterior columns of the spinal cord produce sensory deficits, not paralysis.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map. This answer is INCORRECT.

The lateral portion of the motor map controls face muscles.

E. Left motor cortex, medial (superior) portion of motor map.

Following a strenuous workout with his neighborhood team, a right-handed, 52-year-old former professional basketball player awoke the next morning with paralysis of the right lower extremity. A neurological exam revealed an exaggerated stretch reflex. There was no disturbance of position sense, pain sensation or tactile discrimination. Where is the problem localized?

A. Anterior (ventral) horn, right side.

B. Cerebellum, right side.

C. Posterior (dorsal) columns of spinal cord, right side.

D. Left motor cortex, lateral (inferior) portion of motor map.

E. Left motor cortex, medial (superior) portion of motor map. This answer is CORRECT!

Lesions to the medial portion of the motor map produce contralateral paralysis of the lower parts of the body.


Astilbin, Found in Plants, Protects Neurons and Improves Motor Control, Mouse Study Finds

A compound found in various types of plants, called astilbin, can protect neurons by preventing over-activation of glia cells (nerve cells that support neurons), excessive alpha-synuclein production, and oxidative stress, researchers working in a mouse model of Parkinson’s disease report.

Parkinson’s disease is mainly caused by the gradual loss of dopaminergic neurons in the substantia nigra, a region of the brain responsible for movement control.

The disease also seems to be associated with over-production of the protein alpha-synuclein in nerve cells of the brain. When this protein clumps together, it gives rise to small toxic deposits inside brain cells, inflicting damage and eventually killing them.

Parkinson’s characteristic symptoms are related to the resulting loss of dopamine-producing nerve cells, and its therapies typically focus on restoring dopamine signaling in the brain to ease problems with movement and balance.

Astilbin, a flavanonol also found in alcoholic beverages (it’s a constituent of wine grape), is known to possess anti-inflammatory, anti-oxidant, and neuroprotective properties.

For this reason, a team of Chinese researchers tested whether astilbin could protect neurons from damage in mice chemically induced to develop Parkinson’s disease.

Researchers injected animals with MPTP — a neurotoxin that has been shown to trigger Parkinson’s symptoms in mice and non-human primates — once a day for five days. Once the animals showed classic Parkinson’s symptoms of motor impairment, they were treated with either astilbin or a saline solution (as a control group) for another seven days.

Behavioral tests revealed that mice given astilbin showed a remarkable improvement in motor function compared to control animals, with significant differences seen in movement scores on a pole and traction test between treated and untreated diseased mice.

Ask questions and share your knowledge of Parkinson’s Disease in our forums.

Biochemical and molecular analysis also showed that astilbin blocked the drop in dopamine brain levels that’s associated with MPTP treatment, minimized the loss of dopaminergic neurons and the activation of glia cells in the substantia nigra, prevented over-production of alpha-synuclein, and reduced oxidative stress — the cellular damage that occurs as a consequence of high levels of oxidant molecules.

Moreover, researchers reported that astilbin activated PI3K/Akt signaling — a chemical cascade involved in the survival and growth of dopaminergic neurons — in the brain after MPTP administration. This finding suggests, they wrote, “that treatment with AST [astilbin] prevents the loss of dopaminergic neurons in MPTP-induced PD [Parkinson’s disease] mice by inducing the activation of the PI3K/Akt signaling pathway.”

Astilbin “exerts neuroprotective effects” on the diseased mice “by suppressing gliosis [activation of glia cells], α-synuclein overexpression and oxidative stress, suggesting that AST could serve as a therapeutic drug to ameliorate PD,” the researchers concluded.


Podívejte se na video: Přednáška obecná histologie LF Plzeň 7. 4. 2020 - revize pojivové tkáně, krve a krvetvorby (Leden 2022).