Informace

Hledání datové sady Rna-Seq pro C. Elegans (Caenorhabditis elegans)


Chci najít datovou sadu RNA-Seq pro C. Elegans, která by ji použila v softwaru RNA-Skim. Pro ty, kteří neznají RNA-Skim, dovolte mi to trochu vysvětlit. Jedná se o nástroj, který se používá ke kvantifikaci dat RNA-Seq pomocí sig-mers(speciální druh k-mer). Nejprve RNA-Skim shlukuje geny kódující proteiny a nachází podřetězce, které jsou pro shlukování tohoto genu speciální. Po této fázi přípravy vezme jako vstup data RNA-seq a pokusí se v nich kvantifikovat transkripty. Takže musím najít datovou sadu v formát souboru fasta pro tento krok. Jelikož jsem v této oblasti docela nový, je tu někdo, kdo by mi mohl poskytnout informace o tom, jak je mohu najít? Kompletní informace o RNA-skim najdete zde: RNA_SKIM

UPRAVIT Typ datové sady, kterou hledám, je něco takového: http://codepad.org/n3ioT3nj. Tato datová sada je pro myš, potřebuji najít takovou datovou sadu pro C. elegans, jak jsem řekl dříve


Přejděte na NCBI-SRA nebo GEO a vyhledejte data RNAseq. Nastavit organismus jako C. elegans a případně další klíčová slova, která vás zajímají. Tento hledaný výraz vám poskytne všechna data RNAseq v SRA od C. elegans:
(„caenorhabditis elegans“ [Organismus]) A „strategie rna seq“ [Vlastnosti]
Soubory obvykle najdete v rychlý formát, který můžete snadno převést do formátu fasta. Existuje mnoho nástrojů, které to dělají; můžete to také provést pomocí vlastního skriptu. Následující příkaz awk provede svou práci:

awk 'NR%4 == 1 {print ">" substr (0,2 $)} NR%4 == 2 {print}' data.fastq> data.fasta

Kromě SRA se můžete podívat také na ENA (European Nucleotide Archive) a DDBJ


Kombinace jednobuněčného sekvenování RNA s molekulárním atlasem odhaluje nové markery pro C. elegans třídy neuronů

Jednobuněčné sekvenování RNA (scRNA-seq) Caenorhabditis elegans (C. elegans) nervový systém nabízí jedinečnou příležitost získat profil částečné exprese pro každý neuron ve známém konektomu. V návaznosti na nedávná data scRNA-seq [1] a na molekulárním atlasu popisujícím expresní vzorec

800 genů s rozlišením jedné buňky [2], navrhli jsme iterativní shlukovací analýzu, jejímž cílem je sladit každý buněčný klastr s

100 anatomicky definovaných neuronových tříd C. elegans. Tento heuristický přístup úspěšně zařadil 58 klastrů do jejich odpovídající třídy neuronů. Dalších 11 klastrů seskupených tříd neuronů sdílejících blízké molekulární podpisy a 7 klastrů nebylo přiřazeno. Na základě těchto 76 molekulárních profilů jsme navrhli 15 nových validovaných promotorů specifických pro neuronovou třídu in vivo. Mezi nimi 10 představuje jediného specifického promotora, který byl dosud hlášen, a rozšiřuje tak seznam neuronů přístupných genetickým manipulacím. Nakonec jsme pozorovali diferenciální expresi funkčně relevantních genů mezi senzorickými, inter- a motorickými neurony C. elegans, což naznačuje, že způsob funkční diverzifikace se může lišit podle neuronálních modalit.


Materiály a metody

C. elegans kmeny

Použili jsme dva homozygotní mutantní kmeny: fem-3 (q96gf) IV, který je citlivý na teplotu, a mlha-2 (q71) V. The fem-3 (q96gf) zásoby byly udržovány na 15 ° a experimentální zvířata pěstovaná na 22 ° mlha-2 mutanti byli udržováni na 22 °. Pro kontrolu imunoznačení jsme použili kmen Bristol divokého typu N2, pěstovaný také při 22 °.

Pitva gonád pro imunologické barvení

Synchronizovaní mladí dospělí (0 a#x020132 hodin po L4 na dospělý molt) byli rozřezáni těsně za hltanem v PBS-Tween (0,1% Tween20) s 0,25 mM zvířata pitvaná levamisolem byla fixována ve 3% paraformaldehydu, 0,1 M K2HPO4 po dobu 30 minut a permeabilizovány ve 100% methanolu při � ° po dobu 30 minut. Vzorky byly třikrát promyty v PBST a blokovány v PBST plus 0,5% BSA po dobu 30 minut při teplotě místnosti. Vzorky byly inkubovány s primárními protilátkami při 4 ° přes noc v PBST plus 0,5% BSA v následujícím ředění: myší anti-SP56 (1: 100) (dárek od S. Strome) a králičí anti-RME-2 (1: 500) (dárek od B. Granta). Poté byly inkubovány se sekundárními protilátkami konjugovanými s Cye3 a FITC (Jackson ImmunoResearch), obě v ředění 1: 1000 v PBST plus 0,5% BSA, po dobu 1 hodiny při pokojové teplotě. Nakonec byly vzorky připevněny na podložní sklíčka ve VectaShieldu obsahujícím DAPI pro vizualizaci DNA a zobrazeny mikroskopem Zeiss Axioimager.

Izolace gonád pro extrakci RNA

Synchronizovaní mladí dospělí (0-2 hodiny po L4 do dospělého molta) byli nejprve řezáni za hltan, jak je popsáno výše. Gonadální paže byly poté uříznuty u spermií nebo v jejich blízkosti, aby se izolovaly od jatečně upraveného těla. Celková RNA byla extrahována z gonád pomocí TRIzol (Invitrogen) a RNeasy Mini Kit (Qiagen) podle pokynů výrobce.

Replikáty a sekvenování

Vygenerovali jsme osm nezávislých vzorků pro mlha-2 a dalších osm pro fem-3. Každý vzorek obsahoval přibližně 30 gonadálních ramen a většina (14/16) měla celkovou koncentraci RNA 20 � ng/ml. Biotechnologické centrum University of Wisconsin připravilo knihovny pro každý vzorek pomocí sekvenačního protokolu TruSeq Illumina, který zahrnuje čištění mRNA (výběr poly-A) a fragmentaci, syntézu cDNA, opravu konce, ligaci adaptérů a obohacení fragmentu DNA. Každá knihovna byla kódována čárovým kódem a sekvenována ve čtyřech různých pruzích, aby se získaly 101-bp čtení na jednom konci pomocí Illumina HiSeq2000. V průměru jsme získali více než 36 milionů přečtení skóre vysoké kvality (㸵 průměrné skóre kvality) na vzorek. Všechna data sekvenování jsou k dispozici v Omnibusové databázi National Institutes of Health Gene Expression pod přístupovým číslem <"type": "entrez-geo", "attrs": <"text": "GSE57109", "term_id": "57109"> > GSE57109.

Přepisová analýza

Použili jsme TopHat2 v2.0.11 (s možností −g 1) (Trapnell a kol. 2012) zarovnat čtení do souboru C. elegans referenční genom (WBcel235.75.fa) a anotace genů (WBcel235.75.gtf) ve WormBase WS240 (Ensembl) (Flicek a kol. 2014). Kvůli kompatibilitě se softwarem pro počítání funkcí jsme vytvořili seřazené a indexované verze SAM souborů BAM (SAMtools) (Li a kol. 2009). Abychom vytvořili datovou sadu počtu čtení, zpracovali jsme soubory SAM pomocí skriptů pythonu popsaných jinde (Anders a Huber 2010). Naše mezní hodnota byla dvě mapovaná čtení na gen pro každý z osmi replikátů nebo minimálně 16 celkových čtení na gen, aplikované na každého mutanta nezávisle. Byly odstraněny geny s nejednoznačnými anotacemi nebo menším počtem čtení (㰖 čtení/gen). K identifikaci diferenciálně exprimovaných transkriptů jsme použili balíček R/Bioconductor DESeq, běžnou metodu pro hodnocení diferenciální exprese (Anders a Huber 2010 Rapaport a kol. 2013). DESeq provádí normalizaci použitím škálovacího faktoru na každý vzorek, tento škálovací faktor je medián vypočtený z poměrů počtu čtení pro každý gen ke geometrickému průměru všech vzorků (Anders a Huber 2010 Rapaport a kol. 2013). Také jsme určili početnost jako rpkm pomocí Cufflinks v2.1.1 (s možnostmi −N, −u a 𢄫) (Trapnell a kol. 2012) (Podpůrné informace, tabulka S1). Celkem jsme našli 10 754 jednoznačně exprimovaných genů s alespoň 16 jedinečně kvalitně zarovnanými čteními. Pro vykreslování dat jsme použili balíček ggplot2 R/Bioconductor (Wickham 2009).

Analýza využití exonu

K zarovnání čtení k C. elegans referenční genom (WS235). Použili jsme Cufflinks v2.1.1 (s možnostmi −N, −u a 𢄫) (Trapnell a kol. 2010 Trapnell a kol. 2012) shromáždit izoformy a změřit expresi izoform. Pro analýzu využití diferenciálního exonu mezi spermatogenními a oogenními gonádami jsme použili balíček DEXSeq pro R/Bioconductor (Anders a kol. 2012). Čtení na exon jsme získali ze souborů zarovnání pomocí skriptu doprovázejícího balíček DEXSeq. Aby byl exon skóroval výrazně odlišně, nastavili jsme míru falešného objevu ρ% a požadavek na minimální násobnou změnu dvakrát. Také jsme nastavili minimální práh výrazu pro dvě čtení na exon. Použili jsme genové anotace ve WS240 a vlastní skript k porovnání našich diferenciálních výsledků exonů s anotovaným alternativním využitím exonu. Vlastní skripty byly také použity k počítání počtu spojení exonů –spanning čtení pro soubory zarovnání, aby se určilo, zda bylo alternativní použití exonu v kódující nebo nekódující oblasti, a k rozlišení typů pozorovaného alternativního sestřihu. Pro zobrazení alternativního spojování souborů WIG, které byly převedeny ze souborů BAM pomocí SAMtools mpileup (SAMtools) (Li), byl použit UCSC Genome Browser ce10 (www.ucsc.genome.edu). a kol. 2009) a vlastní skript.


Shrnutí autora

C. elegans je nejjednodušší vícebuněčný modelový systém s pouze 959 somatickými buňkami u plně vyvinutého dospělého. Tato práce popisuje izolaci a RNA-seq analýzu hlavních dospělých tkání červa. Dříve izolaci dospělých tkání bránila tvrdá vnější kutikula červa, ale identifikace transkriptomů dospělých tkání je nezbytná k pochopení biologie dospělých, která se podstatně liší od embryonálních a larevních buněk. Nedávno jsme vyvinuli metodu izolace a RNA sekvence dospělých tkání a zde jsme ji použili k charakterizaci transkriptomů a profilů dospělých svalů, neuronů, střev a epidermis. Data odhalují zajímavé nové vlastnosti pro tkáně dospělých, zejména metabolickou funkci podkoží, které jsme funkčně testovali. Tkáňové transkriptomy byly také použity k identifikaci relevantních ortologů lidské tkáně nezaujatým způsobem. Nakonec představujeme nový predikční nástroj pro genovou expresi až v 76 tkáních a typech buněk a demonstrujeme jeho užitečnost nejen při predikci buněčně specifické genové exprese, ale také při diagnostice změn exprese v různých genetických drahách a kontextech.

Citace: Kaletsky R, Yao V, Williams A, Runnels AM, Tadych A, Zhou S, et al. (2018) Analýza transkriptomů dospělých Caenorhabditis elegans buňky odhalují tkáňově specifický gen a expresi izoformy. PLoS Genet 14 (8): e1007559. https://doi.org/10.1371/journal.pgen.1007559

Editor: Gregory S.Barsh, Stanford University School of Medicine, SPOJENÉ STÁTY

Přijato: 14. března 2018 Přijato: 13. července 2018 Zveřejněno: 10. srpna 2018

Autorská práva: © 2018 Kaletsky a kol. Toto je článek s otevřeným přístupem distribuovaný za podmínek licence Creative Commons Attribution License, která umožňuje neomezené použití, distribuci a reprodukci v jakémkoli médiu za předpokladu, že je uveden původní autor a zdroj.

Dostupnost dat: Sekvence jsou uloženy v NCBI BioProject PRJNA400796.

Financování: CTM je ředitelem Glennova centra pro výzkum stárnutí v Princetonu a vědeckým pracovníkem HHMI-Simons. OGT je vedoucím pracovníkem programu Genetic Networks Kanadského institutu pro pokročilý výzkum (CIFAR). Tato práce byla podpořena NIH (DP1 Pioneer Award (GM119167) a Cognitive Aging R01 (AG034446) to CTM, and R01 GM071966 to OGT), jakož i Glenn Medical Foundation. VY a AMR byly částečně podpořeny granty NIH T32 HG003284 a T32GM007388. Finančníci neměli žádnou roli při návrhu studie, sběru dat a analýze, rozhodování o zveřejnění nebo přípravě rukopisu.

Konkurenční zájmy: Autoři prohlásili, že neexistují žádné protichůdné zájmy.


Diskuse

Klíčovými poznatky z této studie jsou redukce dynamiky genové exprese na jednorozměrný rozmanitý proces odhalený analýzou hlavních komponent (PCA), stabilita podpisu stárnutí v biologických podmínkách, škálování vlastní podobnosti trajektorií transkriptu stárnutí a křivek přežití „ustálení experimentální úmrtnosti na predikované úrovni Gompertzova exponenta a identifikace nové potenciální farmaceutické léčby prodlužující život.

Pozorované rysy dynamiky stárnutí lze vysvětlit pomocí hypotézy „stárnutí při kritičnosti“ 12. Tato hypotéza navrhuje, aby genové regulační sítě většiny druhů fungovaly v blízkosti bifurkačního bodu 50 s poruchou uspořádání a byly vnitřně nestabilní. V těsné blízkosti rozdvojení je dynamika fyziologického stavu organismu efektivně jednorozměrná. Taková redukce trajektorie vektoru fyziologického stavu v multidimenzionálním prostoru genového transkriptu nám umožňuje kvantifikovat postup stárnutí pomocí jediné stochastické proměnné představující biologický věk. Tento přirozený indikátor stárnutí organismu je přímo spojen s úmrtností (další podrobnosti viz Metody). Tato vlastnost základní regulační sítě genů je společným rysem komplexních sítí bez ohledu na to, jak je síť složitá a velká, systém lze charakterizovat jeho přirozeným stavem a řídícími proměnnými, čímž lze systém efektivně popsat pomocí jednorozměrné nelineární rovnice 51,52. Přitom se zavádí účinný parametr na úrovni organismu, který kombinuje všechny mikroskopické vlastnosti topologie sítě do jednoho čísla, tuhosti nebo odolnosti sítě (protějšek rychlosti stárnutí). Proměnná efektivního stavu je dalším makroskopickým parametrem (parametr pořadí), který hraje roli indikátoru procesu stárnutí a lze mu připsat význam biologického věku.

Zjevná stabilita podpisu stárnutí v značně odlišných biologických podmínkách není z teoretického hlediska překvapivá, protože podpisy životnosti a stárnutí se vztahují k nejmenšímu vlastnímu číslu a příslušnému vlastnímu vektoru matice interakce gen-gen. Malé odchylky, jako jsou účinky mutací nebo RNAi, tedy způsobují malé posuny v již malé vlastní hodnotě, a proto mohou vést k velmi velkým změnám v délce života. Současně jsou změny v směr stárnutí Očekává se, že slabá porucha bude malá. Závěr je poměrně obecný a platí pro stárnutí u jiných druhů, viz např. PCA úrovní genové exprese u normálně krmených a kaloricky omezených much 53,54.

Vzhledem k robustnímu a efektivně jednorozměrnému charakteru změn během stárnutí by bylo možné použít dostatečně velký datový soubor k vytvoření univerzálního transkriptomického biologického modelu věku, jako je ve své nejjednodušší formě regrese úrovní genové exprese v chronologickém věku, vhodné pro budoucí studie stárnutí v C. elegans. Velikost a znak příspěvků jednotlivých transkriptů k biologickému věku nejsou jedinečné kvůli vysoké kovarianci v každé podskupině koordinovaně exprimovaných genů. Model by měl být stanoven jakýmkoli rozumným dodatečným požadavkem, jako je například řídkost, a proto nemá žádný přímý fyzický nebo biologický význam kromě poskytnutí vhodného nástroje pro experimentální analýzu dat.

Biologický věk jako funkce chronologického věku definuje trajektorii stárnutí, a lze jej tedy použít k rozlišení progrese stárnutí napříč kmeny. Od raného věku, přibližně do průměrné délky života, je věkem závislý vzestup biologického věku univerzální funkcí bezrozměrné věkové proměnné, získané změnou měřítka chronologického věku na délku života kmene. To lze snadno interpretovat, pokud je vliv stochastických sil po určitém věku malý, a proto je postup téměř deterministický se stejnou časovou stupnicí definující tvar variací genové exprese a hodnotu průměrné délky života. Teoreticky se to stane vždy, když průměrná délka života výrazně překročí dobu zdvojnásobení úmrtnosti. V praxi je předpoklad pouze kvalitativně správný, ale přesto poskytuje rozumné vysvětlení experimentální situace. Podle modelu je časové měřítko definováno základní tuhostí regulační sítě genů, a tím mechanicky souvisí vlastnosti na úrovni organismu, jako je životnost, s potenciálně modifikovatelnými interakčními vlastnostmi na molekulární úrovni základní regulační sítě, jako je charakteristická molekulární a míry genetického poškození a oprav 54.

Očekáváme, že dynamika genové exprese a mortalita by měla stále více záviset na nelinearitě postupně se rozpadající genové regulační sítě, protože ji stárnoucí drift a stochastické síly narušují. Velké odchylky úrovní genové exprese od mladistvého stavu jsou neslučitelné s přežitím. Stochastická dynamika biologické věkové proměnné tedy poskytuje mechanistickou vazbu na úmrtnost. Univerzálnost škálování variací v úrovních transkriptů genů, podél trajektorie stárnutí ukázané na obr. 3 (a), by měla být zase molekulárním základem pro časové škálování křivek přežití 13. V této studii byli hlístice vystaveni různým stresům zkracujícím život a jejich délky života byly sníženy takovým způsobem, že jakékoli dvě křivky přežití mohly být překryty jednoduchým změnou měřítka věku. Naše data o přežití s ​​mutacemi prodlužujícími život, interferencí RNA a farmakologickými intervencemi se řídí stejným vzorem. Transformace škálování funguje výjimečně dobře a spojuje trajektorie stárnutí zvířat s drasticky odlišnými průměrnými délkami života dospělých: od pouhých 17 dní pro kontrolní červy divokého typu N2-DRM po 160 dní pro stáří-1(mg44) mutanti. Zda lze časové škálování trajektorií stárnutí zobecnit na intervence zkracující život, zatím nebylo prozkoumáno a může být komplikováno množstvím cest, jejichž narušení zkracuje životnost.

Časové škálování trajektorií stárnutí a křivek přežití je samozřejmě přibližné, protože genová exprese a délky života závisí také na náhodných environmentálních a endogenních faktorech. To může být vysvětlením odchylek od časového škálování křivek přežití u různých replikátů stejného kmene v odkazu. 13. Určité vnější podmínky nebo terapeutické intervence mohou v zásadě způsobit zpoždění nebo zrychlení vývoje bez změny rychlosti stárnutí, a tím způsobit odchylky od chování univerzálního škálování. Kmen DR1694, který v naší analýze ukazuje nejvíce nesouhlasnou křivku přežití, může být příkladem takového chování a zaslouží si nezávislou studii. DR1694 je jediný kmen nesoucí dvě mutace (na geny kódující inzulínový/IGF1 receptor a nukleární hormonální receptor).Tyto dva mutované geny interagují alelicky specifickými způsoby, takže některé kombinace trvají krátce, zatímco jiné poměrně dlouho. To naznačuje křehkou rovnováhu mezi genovými produkty, které ovlivňují životnost.

Biologický věk by se měl ustálit zhruba na průměrné délce života, což je skutečně pozorováno ve všech našich experimentálních kohortách v 10násobném rozmezí rozdílu délky života (obr. 3 (a)). Jak se biologický věk blíží mezní hodnotě, úmrtnost také zpomaluje a dosahuje plató na úrovni Gompertzova exponentu získaného exponenciálním přizpůsobením ve věkovém rozmezí blízkém průměrné délce života 12. Pomocí vysoce kvalitních údajů o přežití 13 jsme plně potvrdili teoretickou predikci a ukázali, že úmrtnost závislá na věku v C. elegans skutečně zpomaluje a v pozdním věku dosahuje náhorní plošiny blízko očekávané úrovně. Tento jev není omezen na experimenty s hlísticemi 55 a pravděpodobně je základem plató úmrtnosti pozorované dříve u velmi velkých populací medvědů a ovocných mušek 56,57,58,59,60,61, které jsme zde rozšířili na relativně malé a homogenní populace C. elegans (Obr. 5). Výsledky odpovídají očekáváním a společně s univerzálností škálování trajektorie stárnutí, jak v transkriptomech, obr. 3 (a), tak odpovídajícími křivkami přežití, obr. 3 (b), podporují náš teoretický model.

U lidí je existence platforem úmrtnosti předmětem diskusí 62, 63, 64, 65, 66, 67, 68, většinou kvůli nedostatku přeživších do věku, který do značné míry přesahuje průměrnou lidskou délku života. Nedostatek těchto údajů má za následek vysokou citlivost plató lidské úmrtnosti na demografické chyby 66,68. Naproti tomu pro C. elegans jsou k dispozici vysoce kvalitní údaje o úmrtnosti až do dvojnásobku průměrné délky života hlístic, takže v tomto konkrétním případě je artefaktová povaha platforem úmrtnosti nepravděpodobná.

Bylo navrženo více vysvětlení pro ustálení úmrtnosti v pokročilém věku 69,70,71, vše zahrnující multiparametrické modely. Hlavní výhodou našeho přístupu je, že alespoň v C. elegans„exponenciální nárůst úmrtnosti dříve v životě a saturace úmrtnosti v pozdějším věku jsou vysvětleny v rámci jednoduché teorie reakční kinetiky závislé pouze na jediném parametru. Tento parametr je identifikovatelný se zdvojnásobujícím exponentem míry úmrtnosti měřeným ve středním věku na úrovni populace a se základní tuhostí regulační sítě na mikroskopických molekulárních úrovních.

Kvantifikace postupu stárnutí pomocí jediného čísla, jako je regrese na věk fyziologických proměnných představujících stav organismu, získává v komunitě stárnoucích výzkumů na síle. Jedním z nejúspěšnějších modelů tohoto druhu je „věk methylace DNA“, což je vážený součet vlastností methylace DNA, vycvičených k „předpovídání“ chronologického věku u lidí 72,73,74 a myší 75,76. Poznamenáváme však, že praktická užitečnost konceptu biologického věku implicitně závisí na předpokládané nedostatečné variabilitě rychlosti stárnutí ve studii. Zde uváděná univerzálnost škálování trajektorie stárnutí naznačuje, že tento předpoklad nemusí být nutně pravdivý, alespoň v experimentech s C. elegans. Přesto je rychlost stárnutí u myší 77 a u lidí 78,79,80 zjevně stabilní, což naznačuje, že životnost je u savců mnohem přísněji regulována než u nematodů-v souladu s nedostatkem spontánních, velmi dlouhověkých mutantů mezi „vyššími“ ”Organismy.

Rostoucí stochastické heterogenní efekty (včetně vyrovnání úmrtnosti a biologického stárnutí) pomáhají vysvětlit, kdy by měla být použita léčba proti stárnutí, aby se dosáhlo co největšího účinku. Spekulujeme, že v pre-embryonálních a embryonálních stádiích u nejjednodušších zvířat nebo na počátku života u lidí je růst organismu do značné míry určen vývojovým programem. V pokročilejším věku si stochasticita kinetiky genové regulační sítě vybírá svou daň a vede ke zvyšování fenotypové heterogenity na všech úrovních. V souladu s tím očekáváme, že intervence proti stárnutí v raných fázích budou mít širší a obecnější účinek na stárnutí u různých druhů. Naproti tomu intervence aplikované v pozdním věku by měly být přesně zvoleny tak, aby pomohly léčit specifické podmínky jednotlivce v daném bodě podél trajektorie stárnutí, což je důsledek životní historie ve formě stochasticky nahromaděných chyb.

Univerzální signatura stárnutí se skládá z relativně malého počtu genů (méně než 7% všech dostupných transkriptů), které jsou obohaceny o cíle regulátorů genové exprese, které podporují dlouhověkost různými cestami, jako je DAF-16 (dobře studovaný Transkripční faktor FOXO, který zprostředkovává klíčové cesty dlouhověkosti) 81, ELT-2 (transkripční faktor regulující navazující složky střevní nadměrné exprese dráhy DAF-2/DAF-16 prodlužuje životnost 15–25% 36), ELT-6 (RNAi prodlužuje životnost 37 ), NHR-1, NHR-10, NHR-86, ZTF-9, nechat-7 a miR-60 (úplná analýza nadměrného zastoupení je uvedena v tabulce 3). Bylo by tedy zajímavé experimentálně otestovat některé z necharakterizovaných zásahů z našich seznamů. Testovali jsme, zda farmaceutické intervence (azacytidin, metamizol, alsterpaullon a anisomycin), u nichž se předpokládá, že způsobí poruchy způsobené změnami stárnutí, sníží rychlost stárnutí a prodlouží životnost, a ukázali jsme, že skutečně prodlužují životnost. Verze rozsáhlé databáze sloučenin LOPAC s 1280 položkami byla již testována na efekty prodlužující životnost v C.elegans 6. Přesto zde nebyly testovány tři z našich čtyř hitů (metamizol, alsterpaullon a anisomycin) a čtvrtý (azacytidin) byl testován s negativním výsledkem, což je pravděpodobně způsobeno toxicitou při vyšší dávce 33 μM používané pro primární screening. V našem experimentu byly všechny léky účinnější v 1 μM než v 10 μM, což naznačuje určitou toxicitu při vyšší dávce. To je nejzřetelnější u anisomysinu, který je v 10 neutrální nebo škodlivý μM.

Alsterpaullone je ATP kompetitivní inhibitor cyklin-dependentních kináz (Cdk1/cyklin B, Cdk2/cyklin A a Cdk5/p25) a s ještě větší účinností glykogen syntázy kinázy GSK-3β. Prostřednictvím posledně uvedené aktivity inhibuje patogenní fosforylaci tau u Alzheimerovy choroby a může mít další patogenní cíle. Metamizol nebo dipyron je inhibitor cyklooxygenázy-3 (Cox-3), u kterého se pozoruje aktivace opioidních a kanabinoidních receptorů, není však považován ani za opioid, ani za NSAID. Klinicky se používá jako analgetikum s antipyretickými a spasmolytickými vlastnostmi, ale pouze s minimálním protizánětlivým účinkem. Snižuje horečku vyvolanou lipopolysacharidy (cestou nezávislou na prostaglandinu a nezávislou cestou) a narušuje biosyntézu inositolfosfátu. Anisomycin, také známý jako flagecidin, je bicyklický derivát tyrosinu, který je produkován Streptomyces griseolus a inhibuje aktivitu peptidyltransferázy eukaryotických ribozomů. Sekundárně interferuje se syntézou DNA, indukuje apoptózu v různých typech buněk a používá se také jako prostředek proti prvokům. Bylo by zajímavé zjistit, zda přednostně indukuje apoptózu v senescentních buňkách, jako je azithromycin. Aktivuje stresové a mitogenem aktivované proteinové kinázy (SAP a MAP kinázy) včetně Jnk a p38/Mapk. Azacytidin je analogem cytidinu, který po začlenění do DNA (a případně RNA) nevratně váže a inaktivuje DNA methyltransferázy. Poznamenáváme, že může inhibovat další cíle, např. enzymy nebo transkripční faktory, které vážou cytidin nebo deoxycytidin. Azacytidin a jeho deoxyderivát, 5-aza-2'-deoxycytidin, se používají k léčbě myelodysplastického syndromu a řady rakovin, u nichž byly epigeneticky umlčeny anti-onkogeny. Vzhledem k různorodým mechanismům těchto léků je velmi pravděpodobné, že se budou navzájem doplňovat v „koktejlu“ s více léky. Kromě toho má každé léčivo známé škodlivé vedlejší účinky, kterým je možné se vyhnout nebo je minimalizovat při nízkých dávkách evidentně požadovaných pro gero-ochranu, a zejména v lékových kombinovaných formulacích.

Pozorované časové škálování křivek přežití a trajektorií stárnutí spolu s robustním vzorcem změn genové exprese spojených se stárnutím se zdálo být univerzální v extrémně rozmanitých biologických podmínkách testovaných v našich experimentech. Z toho usuzujeme, že účinků prodlužujících život je dosaženo spíše stabilizací genové regulační sítě a zpomalením rychlosti stárnutí než kvalitativní změnou molekulárního aparátu celého organismu. To znamená, že průběh stárnutí superdlouhých kmenů lze potenciálně terapeuticky napodobit, a proto by nakonec vedl k dramaticky prodloužené délce života bez škodlivých účinků. Hypotéza „stárnutí na kritičnosti“ se ukazuje jako robustní teoretický a praktický rámec pro porozumění širokému spektru vlastností dynamických pro stárnutí a pro přežití, které jsou užitečné pro budoucí úsilí o identifikaci zásahů proti stárnutí v C. elegans a další druhy.


VÝSLEDEK

Několik tříd genů RNA reaguje na tepelný šok C. elegans

Transkripční odpověď PCG na HS byla intenzivně studována (1,2,35), ale účinek tohoto stresu na expresi nekódující RNA (ncRNA) nebyl systematicky zkoumán. Zde jsme použili sekvenování RNA k porovnání hladin různých typů RNA z posledního larválního stádia (L4) C. elegans udržována na 20°C (ovládání, CTRL) nebo posunuto na 35°C (HS) pro 4 (RNA-seq) nebo 6 h   (smRNA-seq). Spolu s očekávanými změnami v expresi mRNA indukovanými HS (doplňková tabulka S1) odhalilo toto profilování také specifické geny RNA patřící do rodin miRNA, piRNA, lincRNA, nezařazené ncRNA, pseudogenu a opakování, které se změnily alespoň dvakrát v reakci na tepelné napětí (obrázek ​ (obrázek 1A 1A).

HS mění expresi kódujících a nekódujících RNA. (A) K analýze změn v expresi RNA v byly použity malé RNA-seq a RNA-seq s párovanými konci Caenorhabditis elegans posunuto z 20 ଌ (kontrola, CTRL) na 35 ଌ (HS) pro 4 (RNA-seq) nebo 6 h   (smRNA-seq). Uvedeny jsou počty různě exprimovaných genů v každé kategorii RNA. 𠆊LL ’ označuje celkový počet komentovaných genů v každé třídě. (B) Strategie používaná k odfiltrování falešně pozitivních upregulovaných mRNA. Další podrobnosti najdete v části ‘Materiály a metody ’ ’ kódy použité pro filtrování jsou k dispozici na https://github.com/wschrein. (C) DAVID Funkční anotace Klastrování genů nahoru a dolů regulovaných v reakci na HS (41). Jsou zobrazeni reprezentativní členové každého klastru se skóre obohacení > 2. Velikost tečky odpovídá počtu genů v každém shluku. (D) TEA pro geny up- a downregulované v reakci na HS. TEA byla provedena pomocí nástroje Wormbase TEA (45). Zkratky: PVD —Senzorický neuron (polymodální nociceptivní pro mechanosenzaci a termosenzaci), Hyp7 𠅎ntcy syncytium of hyp7, Hyp6 𠅌ylindrical hypodermal syncytium in head, Psub1 𠅎mbryonic zakladatel, x02014Embryonická buňka, Z2 — Prekurzorová buňka linie Germ, Prekurzorová buňka linie Z3 —Germ.

Zatímco naše podmínky vyvolaly změny v expresi mRNA kódující protein srovnatelné s dříve publikovanými studiemi transkripční odpovědi na HS v C. elegans (36,37), všimli jsme si některých zvláštností v upregulované sadě genů. Vizuální kontrola sekvenčních čtení mapovaných do UCSC Genome Browser ukázala několik falešně pozitivních genových volání přítomných v seznamu PCG upregulovaných HS. Například, srt-42 byl původně uveden jako druhý nejvíce vysoce regulovaný gen v HS, ale čtení spojená s tímto genem neodpovídala očekávanému sestřihovému schématu a zahrnovala sekvence protahující se proti proudu do sousedního genu HSP, hsp-16,41 (Obrázek ​ (Obrázek1B). 1B). Tedy čtení pokrývající srt-42 pravděpodobně pocházejí z transkriptů, které se nepodařilo řádně ukončit vysoce indukovaným HS hsp-16,41 gen. Tyto typy aberantních transkriptů, známé jako DoG pro transkripty obsahující gen, byly dříve detekovány v různých stresových podmínkách (38,39). Zatímco funkční role DoGs bude teprve prokázána, neúplné transkripční zakončení vysoce indukovaného upstream genu může poskytnout čtení RNA-seq, které falešně přiřadí downstream gen na stejném řetězci, jako je také upregulovaný (38,39). Protože je nepravděpodobné, že by tyto falešné pozitivy udržely kódovací potenciál, odfiltrovali jsme je z našeho původního seznamu HS-upregulovaných PCG odstraněním 49 genů s četbami v upstream Intergenic Junction, které byly 2krát vyšší v HS a které měly poměr intronického k exonickému čte 0,4 nebo více (obrázek ​ (obrázek1B 1B a doplňková tabulka S1).

Dalším zdrojem mylně nazývaných upregulovaných PCG byla intronická rezidence tRNA a snoRNA, které zjevně nebyly řádně ukončeny v HS (obrázek ​ (obrázek1B). 1B). Tyto delší verze tRNA a snoRNA umožnily jejich detekci ve standardních sekvencích RNA, zatímco normálně kratší formy nejsou v tomto postupu zachyceny. Odfiltrováním genů s poměrem intronů k exonům (IR) ϡ v důsledku akumulace intronické ncRNA v HS jsme odstranili dalších 14 PCG z upregulovaného seznamu (obrázek ​ (obrázek1B 1B a doplňková tabulka S1). Byly také odfiltrovány PCG, které se překrývaly s opakujícím se prvkem, který byl pravděpodobně zodpovědný za zvýšené sekvenční čtení v HS (obrázek ​ (obrázek1B 1B a doplňková tabulka S1). Bioinformatické kroky použité pro filtrování jsou podrobně popsány v materiálech ‘ Metody ’ část a jsou k dispozici online (https://github.com/wschrein).

S vyšší sadou spolehlivosti PCG diferencovaně regulovaných HS jsme potvrdili, že naše podmínky vyvolaly změny v expresi mRNA srovnatelné s dříve publikovanými studiemi transkripční odpovědi na HS v C. elegans (36,37,40). Rozsáhlé změny v expresi PCG indukované HS zarovnané s molekulárními drahami, u nichž se očekává, že budou regulovány tímto stresem. DAVID Gene Ontology (GO) analýzy genů upregulovaných HS ukázaly silné obohacení o ty, které souvisejí s udržováním kutikuly, HSP a enzymatickými faktory (obrázek ​ (obrázek 1C 1C a doplňková tabulka S1) (41,42). Geny v těchto kategoriích mají dobře zavedené role v ochraně před stresem a dříve bylo shledáno, že jsou upregulovány v HS (obrázek ​ (obrázek 1C 1C a doplňková tabulka S1) (26,36,37). Byly zaznamenány výrazné funkční anotace, do značné míry zapojené do vazby nukleové kyseliny obohaceno o geny downregulované HS (obrázek ​ (obrázek 1C 1C a doplňková tabulka S1). Snížená exprese genů spojených s replikací DNA je v souladu se zastaveným růstem a dělením buněk vyvolaným tepelným stresem (1).

Sady genů up- a downregulované také poukazovaly na odlišné reakce tkáně na HS, což je v souladu s buněčnou neautonomní regulací HSR v C. elegans (43,44). Pomocí analýzy obohacení tkáně (TEA) jsme pozorovali, že upregulované geny jsou spojeny s neuronálními a epiteliálními buňkami (obrázek ​ (obrázek1D) 1D) (45). Zejména obohacení v termosenzorických neuronech může odrážet úlohu těchto neuronů při aktivaci HSR buňkově neautonomním způsobem (obrázek ​ (obrázek1D) 1D) (43). Downregulované PCG byly spojeny s reprodukčními tkáněmi, což pravděpodobně odpovídá zpoždění vývoje ve stresových podmínkách.

Poté, co jsme potvrdili, že podmínky HS použité v těchto studiích vyvolaly očekávané změny v expresi PCG, dále jsme zkoumali účinek HS na hlavní třídy genů ncRNA. Zjištění, že konkrétní členové každé třídy ncRNA byly v reakci na HS regulovány nahoru nebo dolů, naznačuje, že HSR řídí transkripci nebo stabilitu specifických ncRNA.

Specifické miRNA reagují na tepelné napětí

Z 205 miRNA, které jsme detekovali sekvenováním malých RNA, bylo 8 upregulováno alespoň 2krát v C. elegans podrobeno HS ve srovnání s podmínkami CTRL (obrázek ​ (obrázek 2A 2A a   B doplňková tabulka S2). V souladu s předchozí studií byl miR-239b jednou z nejvíce vysoce regulovaných miRNA po HS (obrázek ​ (obrázek 2A) 2A a   B) (11). Největší násobná změna byla pozorována u miR-4936, která se zvýšila více než 200krát v HS (obrázek ​ (obrázek 2A 2A – C). Tato miRNA byla prakticky nezjistitelná při teplota CTRL, ale akumulovaná do vysokých hladin v HS (obrázek ​ (obrázek2C). 2C). Kromě toho převládající izoforma, kterou jsme detekovali pro miR-4936 v HS (5 ′ AUUGCUUUGUGGCUUUGCUGGUAAC 3 ′) se liší od referenčního sekvence uvedená na miRBase (5 ′ UGCUUUGUGGCUUUGCUGGUA 3 ′) (46). Očekává se, že tento rozdíl v sekvenci 5 ′ ovlivní rozpoznávání cíle, které je do značné míry poháněno počátečním párováním nukleotidů miRNA 2 𠄷   (sekvence semen) (12) Protože degradace cílové mRNA je často výsledkem miRNA regulace, hledali jsme v souboru downregulovaných PCG komplementární místa v jejich 3 ′UTR se sekvencí semen (nt 2 𠄷) upregulovaných miRNA (doplňková tabulka S2). Predikované cíle těchto miRNA odrážejí GO pojmy spojené s geny, jejichž hladiny klesají v tepelném stresu, jako je vazba 3 ′UTR (obrázek ​ (obrázek2B). 2B). Kromě toho jsou některé z těchto downregulovaných genů potenciálními cíli více upregulovaných miRNA, což naznačuje kooperativitu (obrázek ​ (obrázek2D). 2D). Tato pozorování jsou v souladu s úlohou upregulovaných miRNA přispívat k represi některých PCG v HS.

Exprese specifických miRNA je regulována HS. (A) Exprese miRNA v CTRL proti HS detekovaná malým sekvenováním RNA. Výsledky představují průměr dvou nezávislých biologických replikátů a jsou označeny miRNA reprodukovatelně up- (červená) a down- (modrá) regulovaná ≥ 2krát. (B) Seznam miRNA naváděcích vláken v top 100 exprimovaných miRNA, které jsou reprodukovatelně up- nebo downregulované v reakci na HS. Poslední sloupec ukazuje termín GO potenciálních cílů pro každou miRNA nejvíce obohaceného biologickým procesem (viz doplňková tabulka S2).GO analýza byla provedena pomocí DAVID (41). (C) Analýza exprese miR-4936 v podmínkách CTRL proti HS severním přenosem. 5S rRNA slouží jako kontrola načítání. (D a  E) Síťová analýza diferenciálně regulovaných mRNA cílených alespoň třemi up- nebo downregulovanými miRNA. K kreslení sítí byl použit Cytoscape (https://cytoscape.org) (25).

Zatímco 52 miRNA bylo shledáno downregulovanými v HS, většina z nich byla málo exprimované osobní řetězce původně zpracovaného miRNA duplexu (doplňková tabulka S2). Úrovně pouze 15 miRNA vodicích vláken byly sníženy více než 2krát po HS (obrázek ​ (obrázek 2A 2A a##000a0 B doplňková tabulka S2). Cílové predikce pro 11 downregulovaných miRNA, které patřily mezi 100 nejhojnějších miRNA nejlépe obohacené termíny GO spojené s línáním a pohybem (obrázek ​ (obrázek 2B). 2B). Dvacet jedna z těchto cílových genů má potenciál pro rozpoznávání třemi nebo více miRNA downregulovanými HS, což zvyšuje možnost, že se zvýší jejich exprese geny jsou usnadněny zmírněnou represí miRNA (obrázek ​ (obrázek 2E). 2E). Je zajímavé, že homolog proteinového období lin-42 je silně upregulovaný v HS a predikovaný cíl čtyř různých miRNA se sníženou expresí v HS (obrázek ​ (obrázek 2E 2E a doplňková tabulka S2). Tento gen reguluje cykly línání a funguje jako obecný transkripční represor genů miRNA (47 &# x0201350). Zvýšený výraz lin-42 v HS by mohlo přispět k transkripční represi mnoha genů miRNA. To by bylo v souladu se sníženými hladinami miRNA osobních řetězců, které jsou citlivější na změny v transkripci než stabilní vodicí vlákna (51).

Kromě miRNA jsme také identifikovali 11 979 různých piRNA v našich malých datových sadách sekvenování RNA. Z toho 15 vzrostlo a 63 se snížilo nejméně dvakrát v HS ve srovnání s kontrolními podmínkami (doplňková tabulka S2). Pomocí nástroje piRNA cílové predikce piRTarBase (52) jsme zjistili, že velmi málo diferenciálně regulovaných PCG má potenciál pro regulaci těmito piRNA (doplňková tabulka S2). Je tedy nepravděpodobné, že by omezené rozdíly v hladinách piRNA výrazně přispěly k rozsáhlým změnám exprese PCG pozorovaných u HS.

V HS se hromadí specifické dlouhé nekódující RNA

Na rozdíl od miRNA, kde byl podobný počet hojnějších druhů v HS regulován nahoru a dolů, delší ncRNA primárně vzrostly v hladinách v reakci na tepelný stres. Přibližně 150 genů je označeno jako dlouhé intergenní nekódující RNA (lincRNA) v C. elegans (53). Zatímco funkční role lincRNA jsou do značné míry neznámé, geny lincRNA tts-1 a rncs-1 byly spojeny s drahami dlouhověkosti a stresem (14,15). Prostřednictvím našeho profilování RNA jsme zjistili, že devět relativně hojných lincRNA se zvýšilo a pouze jedna lincRNA se snížila více než dvojnásobně v HS ve srovnání s podmínkami CTRL (obrázek ​ (obrázek 3A 3A a doplňková tabulka S3). Zajímavé je, že tts-1 patřil mezi vysoce upregulované lincRNA, což naznačuje, že jeho role v dlouhověkosti může být spojena se stresovou cestou (14). Alespoň jedna z lincRNA, linc-7, se zdá být rychle upregulován HS (obrázek ​ (obrázek3B). 3B). Je zajímavé, že tato lincRNA obsahuje pět míst s komplementaritou k oblasti osiva rychle upregulované miRNA, miR-239b-5p. Dodatečně, linc-82 obsahuje osm semenných zápasů pro miR-239a-3p a miR-230 𠄳p, z nichž oba se hromadí v HS (obrázek ​ (obrázek 2A 2A a   B doplňková tabulka S2). Tyto potenciální interakce lincRNA –miRNA mohou regulovat stabilitu , dostupnost nebo funkce těchto specifických RNA během HS.

HS mění expresi dlouhých nekódujících RNA. (A) Exprese dlouhých intergenních nekódujících RNA (lincRNA) v CTRL oproti HS detekována sekvenováním spárovaných řetězců. Jsou indikovány významně up- (červené) a downregulované (modré) lincRNA (𢙒-násobná změna s baseMean ≥ 50 a padj < 0,01   ze tří nezávislých replikátů). (B) qRT-PCR analýza hsp-70 a linc-7 Hladiny RNA po 15, 30 a 180 minutách HS versus podmínky CTRL. Jsou ukázány průměrné změny skládání a SEM ze tří nezávislých replikátů. *P π.05, **P  π.01, ***P  π.001 (t-test, oboustranný). (C) Exprese ncRNA v CTRL versus HS detekovaná sekvenováním párovaných řetězců. Jsou označeny výrazně up- (červené) a downregulované (modré) ncRNA (𢙒-násobná změna s baseMean ≥ 50 a padj < 0,01   ze tří nezávislých replikátů). (D) Exprese pseudogenních RNA v CTRL versus HS detekovaná sekvenováním párovaných řetězců. Jsou indikovány významně up- (červené) a downregulované (modré) pseudogenní RNA (𢙒-násobná změna s baseMean ≥ 50 a padj < 0,05 ze tří nezávislých replikátů).

Kromě lincRNA je v C. elegans genom (22). Z toho 71 vzrostlo a 1 se snížilo alespoň 2krát v reakci na HS (obrázek ​ (obrázek 3C 3C a doplňková tabulka S3). Také jsme detekovali expresi pro 1455 pseudogenů a zjistili jsme, že 94 bylo up- a 23 bylo downregulováno v HS.

Při tepelném šoku se hromadí RNA odvozené z opakujících se prvků

Přemapováním našich sekvenčních dat RNA na seznam shody C. elegans opakujících se prvků získaných z repbase (24), identifikovali jsme čtení pro 165 typů opakujících se prvků v souboru C. elegans genom. Bylo zjištěno, že podobný počet opakování (�) zvyšuje nebo snižuje HS, ale velikost změny byla v upregulovaném souboru značně zesílena (obrázek ​ (obrázek 4A 4A a   B doplňková tabulka S4). Zdánlivě silný upregulace CERP16 je pravděpodobně přinejmenším částečně způsobena polohou tohoto prvku bezprostředně za ním hsp-16.2 a hsp-16,41. DoG produkované každým z těchto vysoce indukovaných genů HSP jsou pravděpodobně převládajícím zdrojem čtení pro tento opakující se prvek.

Upregulace více opakujících se elementárních RNA během HS. (A) Exprese RNA opakujících se elementů v CTRL proti HS detekovaná sekvenováním párovaných řetězců a mapována do databáze opakujících se prvků (24). Jsou indikovány významně up- (červené) a downregulované (modré) opakující se RNA (𢙒-násobná změna s baseMean ≥ 100 a padj < 0,05 ze tří nezávislých replikátů). (B) Seznam repetitivních elementárních RNA upregulovaných alespoň 10krát v HS. (C) Semi-kvantitativní RT-PCR detekce uvedených RNA v CTRL a po 15 nebo 30 minutách HS. (D) Kvantitativní RT-PCR analýza hsp-16.2ਊnd Helitron1_CE Exprese RNA v časovém průběhu HS. Jsou ukázány průměrné změny skládání a SEM ze tří nezávislých replikátů. *P < ਀.05, **P < 0,01, ***P < 0,001 (t-test, oboustranný).

Naproti tomu alespoň někteří členové transpozonů DNA s kruhovým kruhem známých jako Helitrony se zdáli být silně indukováni nezávisle na sousedních PCG (obrázek ​ (obrázek 4B 4B a viz níže). RNA z Helitron1_CE rychle nahromaděné na vysoké hladiny po HS (obrázek ​ (obrázek4C 4C a   D). Naše opětovná analýza dříve publikovaných C. elegans Data HS RNA-seq také potvrdila rychlou indukci helitronového repetitivního prvku RNA (36).

HSF-1 řídí expresi specifických ncRNA

Přestože defektní cesty umlčování malých RNA mohou vysvětlit některé ze zvýšené exprese opakované RNA během HS (54), rychlá a masivní akumulace helitronových RNA naznačuje, že je zahrnuta i transkripční indukce. Všimli jsme si toho Helitron1_CE vykazoval HSR srovnatelný s kanonickými geny indukovanými HS, jako je např hsp-16,42, se stěží detekovatelnými hladinami RNA, které rychle stoupají po HS (obrázek ​ (obrázek 4C). 4C). Předpověděli jsme tedy, že stejně jako geny HSP mohou být Helitrony přímými transkripčními cíli HSF-1. Abychom tuto možnost prozkoumali, přemapovali jsme C. elegans HSF-1 a Pol II ChIP-seq data od Li a kolegů, aby zahrnovala opakované a jiné genomové lokusy ncRNA (26). Podobně jako oblast promotoru pro hsp-16.2 a hsp-16,41, našli jsme důkazy pro asociaci HSF-1 a Pol II s Helitron1_CEa další členové rodiny Helitronů, v reakci na HS (obr. (Obrázek ​ (Obrázek 5A 5A a doplňková tabulka S4).

NcRNA jsou během HS regulovány HSF-1. (A) Snímky genomu prohlížeče HSF-1 (žlutá) a Pol II (modrá) ChIP-seq data z kontrolních (CTRL) a HS podmínek (data z (26)) pro reprezentativní geny (hsp-16.2 a hsp-16,41, mRNA Helitron1_CE, opakujte RNA, miR-239a a miR-239b, miRNA dct-10, pseudogen). Jednotlivé HSE identifikované pomocí FIMO (P < 1e-04) jsou uvedeny (30). (B) Skládaná změna hladin RNA hsp16.2, Helitron1_CE, miR-239bਊnd dct-10 po 30 minutách HS u zvířat vystavených prázdnému vektoru nebo hsf-1 RNAi a WT versus kmen nadměrně exprimující HSF-1 (hsf-1 OEX) stanoveno analýzami qRT-PCR. Průměrné změny skládání a SEM ze tří nezávislých replikátů jsou graficky znázorněny. *P < 0,05, **P < 0,01 (t-test, oboustranný).

Interakce HSF-1 s oblastmi Helitron naznačuje, že HSF-1 by mohl přímo přispět k upregulaci Helitron RNA v HS. Pomocí podmínek, které snižují (hsf-1 (RNAi)) nebo zvýšení (transgenní nadměrná exprese hsf-1(OEX)) hladiny HSF-1, pozorovali jsme očekávané opačné efekty na expresi hsp-16.2, zavedený cíl HSF-1, v reakci na HS (obrázek ​ (obrázek 5B). 5B). Stejně tak indukce Helitron1_CE exprese HS byla významně snížena v hsf-1 (RNAi) a vylepšeno v hsf-1 (OEX) podmínky (obrázek ​ (obrázek 5B). 5B). Vzhledem k množství HSE přítomných v některých Helitronech a citlivosti Helitron1_CE na hladiny HSF-1, upregulace těchto opakujících se genů během HS může být do značné míry regulována na transkripční úrovni.

Abychom prozkoumali možnost, že by jiné ncRNA mohly být součástí přímého transkripčního programu HSF-1 v HS, analyzovali jsme jejich domnělé promotorové oblasti (1 kb před anotovaným počátečním místem) na píky HSE a HSF-1 v datech ChIP-seq od Li et ਊl.,   (26). Z upregulovaných miRNA pouze miR-239 lokus odpovídá těmto kritériím (doplňková tabulka S2). Tato oblast se nachází mezi miR-239b a miR-239a, které jsou přepisovány v opačných směrech. Jediný HSE a vyšší úroveň čtení HSF-1 ChIP-seq jsou blíže začátku miR-239b, ale zvýšená obsazenost Pol II v HS je pozorována u obou miRNA, což je v souladu s jejich vzájemnou upregulací v HS (obrázky ​ (obrázky2A 2A a   B a 5A doplňková tabulka S2). Dále jsme zjistili, že snížení nebo zvýšení HSF- Úrovně 1 vedly k nižším nebo vyšším hladinám miR-239b, v uvedeném pořadí, v reakci na HS (obrázek ​ (obrázek 5B). 5B). U upregulovaných delších genů ncRNA byly detekovány HSE a důkaz vazby HSF-1 na HS oblasti promotoru 0 lincRNA, 11 neklasifikovaných ncRNA a 5 pseudogenů (doplňková tabulka S4). V souladu s nádorovým genem kontrolovaným DAF-16/FOXO, dct-10jako jeden z nejsilněji indukovaných pseudogenů jsme zjistili, že jeho promotor obsahuje více HSE a jeho exprese v HS je regulována hsf-1 (Obrázek ​ (Obrázek5 5   a   Doplňková tabulka S4). Celkově tato zjištění poukazují na rozšířenou úlohu HSF-1 při řízení transkripce specifických genů ncRNA jako součásti HSR v C. elegans.


Diskuse

Vysoce kvalitní anotace genomu je zásadní pro přesné přiřazení ortologů, objev bloků synteny a fylogenetickou analýzu molekulární evoluce genů a jejich promotorů. Je také důležitý pro zkoumání molekulární evoluce genů včetně zisku a ztráty intronů (Roy a Gilbert 2005), expanze a kontrakce genové rodiny (Prachumwat a Li 2008) a duplikace segmentálního genomu (Jiang et al. 2007). Srovnávací analýza mezi modelovým organismem C. elegans a jeho nejlépe studované sesterské druhy C. briggsae byla velmi omezena omezenou anotací souboru C. briggsae genom. Jak je uvedeno v nejnovější poznámce k vydání WormBase (WS228), pouze 0,2% (nebo 52) z C. briggsae genové modely jsou plně potvrzeny a 95,9% postrádá jakékoli potvrzení. Existuje pouze velmi malý počet EST a experimentálně určených mRNA pro C. briggsae genom ve veřejných databázích včetně databáze dbEST v GenBank. Pouze 15 C. briggsae genové modely jsou plně podporovány tímto omezeným počtem EST a mRNA. V tomto projektu jsme se pokusili vylepšit a ověřit C. briggsae genové modely. V revidovaném C. briggsae genová sada, 14 812 (68,3%) genů je alespoň částečně validováno, přičemž 7347 (33,9% všech genů s introny) C. briggsae genové modely s validací všech jejich intronů. Na úrovni transkriptu (mRNA/cDNA) bylo u 47,0% (10 235) všech genů validováno alespoň 95% jejich celých délek transkriptů 62 727 (60,9%) intronů C. briggsae genová sada je validována. Všech těchto 15 genových modelů, které jsou podporovány EST v GenBank, je plně podporováno daty RNA-seq, což naznačuje dobré pokrytí C. briggsae transkriptom našimi daty RNA-seq. Kromě toho jsme komentovali 5 ′ sekvencí UTR pro 14 089 C. briggsae geny a 3 ′ sekvence UTR pro 14 089 C. briggsae geny. Naše RNA-seq analýza nám navíc také umožnila úspěšně identifikovat trans-splicing sites in 8555 C. briggsae genových modelů bylo identifikováno 11 617 SL, včetně 8856 SL1 (v 7871 genech) a 2761 SL2 (v 2287 genech). Založeno na trans-při shromažďování informací jsme komentovali 1034 operonů v C. briggsae genom. Tento zásadní pokrok v C. briggsae anotace, validace a potvrzení genomu nepochybně usnadní mnohem přesnější srovnávací analýzu genomiky mezi těmito dvěma důležitými modely hlístic: C. elegans a C. briggsae.

Vylepšení v C. briggsae anotace genomu byla částečně umožněna nedávným a podstatným pokrokem v C. elegans anotace genomu. Tento pokrok je způsoben rozsáhlou sbírkou vysoce výkonných projektů anotace genů a také anotací genů z projektů malého rozsahu v C. elegans výzkumná komunita. Vyvinuli jsme novou sadu algoritmů genBlastA (She et al. 2009) a genBlastG (She et al. 2011), abychom využili výhody vylepšeného C. elegans anotace genomu. To nám umožnilo zlepšit C. briggsae anotace genomu prostřednictvím anotace genomu založené na homologii. GenBlastA zejména předpovídá genomové oblasti, které obsahují kandidátský homologní gen, zatímco genBlastG definuje model homologního genu na základě podobnosti mezi dotazovacím genem a cílovým genem. Toto úsilí mělo za následek revizi 6715 C. briggsae genové modely a přidání 1091 nových genových modelů, které v předchozích anotacích zcela chyběly. Ověření a další zlepšování souboru C. briggsae anotace genomu byla umožněna využitím dat RNA-seq (Hillier et al. 2009 Wang et al. 2009). Tato data byla generována ve vysoké kvalitě C. briggsae transkriptomy a sekvenovány pomocí technologie sekvenování DNA Illumina. Síla RNA-seq nám umožnila validovat genové modely, revidovat defektní genové modely a také detekovat UTR a trans-spojování signálů, což nám zase umožnilo detekovat operony v C. briggsae.

Ukázali jsme, že revidované C. briggsae anotace genomu zlepšila přiřazení ortologu mezi C. elegans a C. briggsae a identifikace bloků synteny mezi těmito dvěma druhy. Všimněte si toho, že zde uvedené výsledky synteny bloku se výrazně liší od naší předchozí zprávy založené na WormBase WS180 (Vergara a Chen 2010). Například největší blok synteny uváděný pomocí anotace WS180 je 42 genů po vylepšení genového modelu (Vergara a Chen 2010), ve srovnání s 21 geny (nebo 25 geny po vylepšení) v této studii. Rozdíl je způsoben začleněním anotací nGASP (Coghlan et al. 2008) do nedávných verzí WormBase, což naznačuje, že mnoho nGASP C. briggsae genové modely jsou pravděpodobně falešně pozitivní, které nesprávně narušují bloky synteny. S největší pravděpodobností budou tyto falešné anotace odstraněny vylepšením genového modelu založeného na důkazech.

S přepisy operonů založených na důkazech v C. briggsae, můžeme poprvé porovnat zachování a divergenci operonů v C. elegans a C. briggsae. Naproti tomu konzervativní analýzy evoluce operonů v předchozích studiích byly všechny prováděny mezi kurátorem C. elegans operony a odhadované operony v C. briggsae (Stein et al. 2003 Qian a Zhang 2008). Porovnání operonů komentovaných v C. elegans (získané z WormBase) pomocí C. briggsae operony kurátorované v tomto projektu pomocí analýzy RNA-seq, potvrdili jsme, že většina (51,4%) operonů je mezi těmito dvěma druhy konzervována. Zjistili jsme však, že zachování operonů není tak vysoké, jak se dříve odhadovalo (tj. 93%�%zachování), protože jsme našli alespoň 153 operonů (14,8%), které jsou zcela C. briggsae charakteristický. Zbývajících 349 operonů (33,8%) je v podstatě konzervováno mezi nimi C. elegans a C. briggsae, ale jejich konfigurace nejsou totožné a mají určitou úroveň divergence.

Očekáváme, že C. briggsae anotace genomu bude dále zlepšena hlubším sekvenováním transkriptomů vzorkovaných z různých typů buněk v různých vývojových fázích.Zejména alternativní izoformy pro C. briggsae budou definovány geny. V této studii jsme zjistili velmi omezenou úroveň zachování alternativně sestřižených genových modelů. Pro geny, které jsou alternativně spojeny C. elegans, jejich ortology v C. briggsae nemusí být nutně alternativně spojeny a naopak. Tento výsledek je zajímavý a odlišné použití alternativních sestřihových izoforem může být důležité pro definování druhové specificity. Rozdíly však mohou být také způsobeny nedostatečnou hloubkou sekvenování transkriptomů pro oba C. elegans a C. briggsae. Hlubší sekvenování bude moci pomoci ověřit tuto hypotézu. Hlubší transkriptomové sekvenování může také najít důkazy na podporu nebo vyvrácení 3072 genových modelů, které v současné době nemají žádnou podporu. Dále hlubší sekvenování C. briggsae transkriptomy nám také umožní vytvořit nové úplné genové modely založené na geneletech odhalených analýzou RNA-seq.

Neočekávaným zjištěním tohoto projektu je pozorování, že proud C. briggsae sestava genomu obsahuje více než 10 tisíc případů genomových chyb. Přestože důvod výskytu těchto chyb je stále neznámý, identifikovali jsme jejich souřadnice a povahu. Tyto chyby lze snadno opravit v souboru C. briggsae genomu (doplňková data 14 �), což umožní opravu stovek genových modelů, které byly nesprávně anotovány, aby se obešel dopad genomových chyb.


Pozadí

Osud organismu může spočívat na jeho schopnosti přesně vycítit a reagovat na stres. Všudypřítomný stres, který často narušuje homeostázu, je kolísání teploty [1]. V důsledku toho mají biologické systémy řadu mechanismů k obnovení homeostázy, když čelí zvýšeným teplotám. Tato přizpůsobení teplotě může být jak evoluční, tak organická. Evoluční adaptace jsou poháněny výběrem dědičných genetických změn. Organické reakce jsou řízeny buněčnými a molekulárními mechanismy.

Když jsou zvířata vystavena zvýšeným teplotám, na úrovni organismu vykazují změny v chování, autonomní reflexy (např. Pocení), kardiovaskulární funkce a neuroendokrinní signalizaci [2]. U hospodářských zvířat je teplota jedním z největších stresorů v živočišné výrobě a mechanismy reakce organismu obvykle škodí výkonu kvůli vysokým metabolickým nákladům [3, 4]. Tepelný stres snižuje růst, reprodukci, produkci mléka a produkci masa a zvyšuje výskyt nemocí. Kromě toho se organismy vyvinuly tak, aby přežily specifický rozsah teplot, a předpovídá se nárůst pouze o několik stupňů, což povede k vyhynutí až 16% všech druhů [5].

Na molekulární úrovni narušují zvýšené teploty homeostázu skládající se z proteinů neboli proteostázu [6]. Proteostáza je normálně udržována rozsáhlou sítí faktorů souhrnně známých jako síť proteostáz, která zahrnuje cesty, které regulují syntézu, skládání, transport a degradaci proteinů. Mnoho proteinů však přijímá nativní stavy, které jsou stabilizovány jen okrajově, takže zvýšení pouze o 4 ° C destabilizuje průměrný protein o

20% v Escherichia coli [7]. Aby se vypořádaly s masivní akumulací chybně složených proteinů během teplotního stresu, využívají všechny organismy adaptivní reakci známou jako reakce na tepelný šok (HSR) [8]. Tato vysoce konzervovaná cesta je zprostředkována faktorem tepelného šoku 1 transkripčního faktoru (HSF1). Mutace v HSF1 způsobují termosenzitivitu, zatímco nadměrná exprese HSF1 zvyšuje termotoleranci [9, 10].

Důležitou třídou genů regulovaných HSF1 je rodina molekulárních chaperonů, která pomáhá při skládání proteinů [11, 12]. Při absenci stresu se chaperony účastní de novo skládání nově syntetizovaných proteinů a buněčných procesů, které vyžadují sestavování a rozebírání makromolekulárních komplexů. Například chaperony jsou nutné pro několik kroků endocytózy [13,14,15]. Počáteční invaginace potažených jamek, disociace klatrinu během povlékání vezikul a stabilizace klatrinu po disociaci jsou regulovány chaperonem HSC70. Další chaperon, RME-8, je důležitý pro následné kroky klatrinem zprostředkované endocytózy a je sdíleným regulátorem jak receptorem zprostředkované endocytózy (RME) v oocytech, tak endocytózy v tekuté fázi v coelomocytech v Caenorhabditis elegans [16,17,18,19]. V přítomnosti stresu pomáhají chaperony opravit špatně složené nebo poškozené proteiny [20]. To slouží k titraci specifických chaperonů mimo inhibiční komplex s HSF1. Aktivita HSF1 je tedy úzce spojena se stavem skládání proteinu v buňce. Podmínky jiné než teplotní stres podobně vedou k titraci chaperonu. Během stárnutí je podstatný pokles kapacity sítě proteostáz přičítán akumulaci špatně složených proteinů spojenou s věkem [21]. S prodlouženou chaperonovou titrací je spojena také řada neurodegenerativních onemocnění [22].

Důsledky stresu jsou zásadně odlišné v závislosti na stupni a délce stresu. HSR byl rozsáhle studován na molekulární úrovni za použití různých modelových systémů vystavených akutnímu, silnému teplotnímu stresu. Fyziologické reakce na teplotní stres u metazoanů jsou však obvykle pozorovány během mírného stresu v mnohem delších časových intervalech. Souvislost mezi molekulárními událostmi, ke kterým dochází během akutního stresu, a reakcemi organismu na chronický stres je třeba ještě plně charakterizovat. Nedávno byly provedeny korelace mezi molekulárními a organickými reakcemi na teplotní stres. Například jsme ukázali, že chronické, 4týdenní vystavení tepelnému stresu v Hippocampus erectus mořští koníci mají za následek změněnou frekvenci krmení a celkovou rychlost ventilace spolu se zvýšenou expresí genů HSR a genů zapojených do regulace reprodukce [23]. Příchod sekvenování nové generace a genomických informací navíc umožnil řadě studií zkoumat transkriptomické reakce na teplotní stres u různých metazoanů [24,25,26]. Přestože tyto studie vytvářejí poklad dat, tato metodika se omezuje na poskytování popisných korelací.

Mnohobuněčný, transparentní hlístice C. elegans je ideálním kandidátem pro zkoumání účinků teplotního stresu na molekulární, buněčné, tkáňově specifické a organizmové úrovni. Akutní, téměř smrtelný teplotní stres (1 h při 33–35 ° C), který vyvolává HSR, nemá hlášené škodlivé účinky na plodnost organismu v C. elegans [27,28,29]. Naproti tomu chronický, mírný teplotní stres (48 hodin při 28 ° C - několik stupňů nad normální růstové teploty 15–25 ° C) zcela inhibuje reprodukci, přičemž pouze mírně ovlivňuje fenotypy, jako je životaschopnost a pohyblivost [30, 31] . Zde kombinujeme genetiku a transkriptomické analýzy s buněčnými a organickými fenotypy, abychom identifikovali molekulární mechanismy pohánějící dramatické rozdíly v osudu mezi akutním a chronickým stresem.


Reference

Moore, M. J. Od narození do smrti: komplexní život eukaryotických mRNA. Věda 309, 1514–1518 (2005)

Martin, K. C. & amp Ephrussi, A. mRNA lokalizace: genová exprese v prostorové dimenzi. Buňka 136, 719–730 (2009)

Ahringer, J. & amp Kimble, J. Kontrola spermio-oocytového spínače v Caenorhabditis elegans hermafroditů od fem-3 3 'nepřeložená oblast. Příroda 349, 346–348 (1991)

Wightman, B., Burglin, T. R., Gatto, J., Arasu, P. & amp Ruvkun, G. Negativní regulační sekvence v lin-14 3'-nepřeložená oblast je nezbytná pro generování časového spínače během Caenorhabditis elegans rozvoj. Genes Dev. 5, 1813–1824 (1991)

Merritt, C., Rasoloson, D., Ko, D. & amp Seydoux, G. 3 'UTR jsou primární regulátory genové exprese v C. elegans zárodečná linie. Curr. Biol. 18, 1476–1482 (2008)

Rogers, A. a kol. WormBase 2007. Nucleic Acids Res. 36, D612 – D617 (2008)

Mangone, M., Macmenamin, P., Zegar, C., Piano, F. & amp Gunsalus, K.C. UTRome.org: platforma pro biologii 3'UTR v C. elegans . Nucleic Acids Res. 36, D57 – D62 (2008)

Mangone, M. a kol. Krajina z C. elegans 3'UTRs. Věda 329, 432–435 (2010)

Nam, D. K. a kol. Oligo (dT) primer generuje vysokou frekvenci zkrácených cDNA prostřednictvím interního poly (A) primingu během reverzní transkripce. Proč. Natl Acad. Sci. USA 99, 6152–6156 (2002)

Hillier, L. W. a kol. Masivně paralelní sekvenování polyadenylovaného transkriptomu C. elegans . Genome Res. 19, 657–666 (2009)

Pruitt, K. D., Tatusova, T. & amp Maglott, D. R. NCBI referenční sekvence (RefSeq): upravená neredundantní sekvence databáze genomů, transkriptů a proteinů. Nucleic Acids Res. 35, D61 – D65 (2007)

Nunes, N. M., Li, W., Tian, ​​B. & amp Furger, A. Funkční lidské poly (A) místo vyžaduje pouze silnou DSE a A-bohatou upstream sekvenci. EMBO J. 29, 1523–1536 (2010)

Evans, D. a kol. Komplex obsahující CstF-64 a SL2 snRNP spojuje tvorbu mRNA 3 'konce a trans-spojení C. elegans operony. Genes Dev. 15, 2562–2571 (2001)

Prescott, E. M. & amp Proudfoot, N. J. Transkripční kolize mezi konvergentními geny v pučících kvasinkách. Proč. Natl Acad. Sci. USA 99, 8796–8801 (2002)

Batista, P. J. a kol. PRG-1 a 21U-RNA interagují za vzniku komplexu piRNA potřebného pro plodnost v C. elegans . Mol. Buňka 31, 67–78 (2008)

Chiang, H. R. a kol. Savčí mikroRNA: experimentální hodnocení nových a dříve komentovaných genů. Genes Dev. 24, 992–1009 (2010)

Ruby, J. G., Jan, C. H. & amp Bartel, D. P. Intronic prekurzory microRNA, které obcházejí zpracování Drosha. Příroda 448, 83–86 (2007)

Friedman, R. C., Farh, K. K., Burge, C. B. & amp Bartel, D. P. Většina savčích mRNA jsou konzervovanými cíli mikroRNA. Genome Res. 19, 92–105 (2009)

Zisoulis, D. G. a kol. Komplexní objev endogenních vazebných míst Argonaute v Caenorhabditis elegans . Přírodní struktura. Mol. Biol. 17, 173–179 (2010)

Clark, A. M. a kol. MicroRNA miR-124 řídí genovou expresi v senzorickém nervovém systému Caenorhabditis elegans . Nucleic Acids Res. 38, 3780–3793 (2010)

Lall, S. a kol. Mapa celého genomu konzervovaných cílů microRNA v C. elegans . Curr. Biol. 16, 460–471 (2006)

Reinhart, B. J. a kol. 21-nukleotid let-7 RNA reguluje vývojové načasování v Caenorhabditis elegans . Příroda 403, 901–906 (2000)

Abrahante, J. E. a kol. The Hrbáč Caenorhabditis elegans-podobný gen lin-57/hbl-1 řídí vývojový čas a je regulován mikroRNA. Dev. Buňka 4, 625–637 (2003)

Tian, ​​B., Hu, J., Zhang, H. & amp Lutz, C. S. Analýza polyadenylace mRNA lidských a myších genů ve velkém měřítku. Nucleic Acids Res. 33, 201–212 (2005)

Wang, E. T. a kol. Alternativní regulace izoformy v transkriptomech lidské tkáně. Příroda 456, 470–476 (2008)

Sandberg, R., Neilson, J. R., Sarma, A., Sharp, P. A. & amp Burge, C. B. Proliferující buňky exprimují mRNA se zkrácenými 3 'nepřekládanými oblastmi a menším počtem cílových míst mikroRNA. Věda 320, 1643–1647 (2008)

Ji, Z., Lee, J. Y., Pan, Z., Jiang, B. & amp Tian, ​​B. Progresivní prodlužování 3 'netranslatovaných oblastí mRNA alternativní polyadenylací během embryonálního vývoje myší. Proč. Natl Acad. Sci. USA 106, 7028–7033 (2009)

Mayr, C. & amp Bartel, D. P. Rozšířené zkrácení 3'UTR alternativním štěpením a polyadenylací aktivuje onkogeny v rakovinných buňkách. Buňka 138, 673–684 (2009)

Lau, N. C., Lim, L. P., Weinstein, E. G. & amp Bartel, D. P. Bohatá třída drobných RNA s pravděpodobnými regulačními rolemi v Caenorhabditis elegans . Věda 294, 858–862 (2001)

Mandel, C. R., Bai, Y. & amp Tong, L. Proteinové faktory při zpracování 3'-konce před mRNA. Cell Mol. Life Sci. 65, 1099–1122 (2008)

Guo, H., Ingolia, N. T., Weissman, J. S. & amp Bartel, D. P. Savčí mikroRNA převážně působí ke snížení cílových hladin mRNA. Příroda 466, 835–840 (2010)

Langmead, B., Trapnell, C., Pop, M. & amp Salzberg, S. L. Ultrafast a paměťově efektivní uspořádání krátkých sekvencí DNA do lidského genomu. Genome Biol. 10, R25 (2009)

Maglott, D., Ostell, J., Pruitt, K. D. & amp Tatusova, T. Entrez Gene: informace zaměřené na gen v NCBI. Nucleic Acids Res. 35, D26 – D31 (2007)

Konsorcium C. elegans Sequencing. Sekvence genomu hlístice C. elegans: platforma pro zkoumání biologie. Věda 282, 2012–2018 (1998)

Blumenthal, T. Trans-sestřih a operony. WormBook 25, 1–9 (2005)

Karolchik, D. a kol. Databáze prohlížeče genomu UCSC. Nucleic Acids Res. 31, 51–54 (2003)


Podpůrné informace

S1 Obr. Ověření protokolu o amplifikaci a sekvenování RNA.

(A) Abychom porovnali přístup amplifikace a sekvenování RNA (RNA-amp-seq) pro vzorky s nízkým vstupem proti standardním sekvencím RNA provedeným na vzorcích s vysokým vstupem, porovnali jsme tyto dvě techniky na stejných vzorcích celkové RNA. Je ukázán reprezentativní korelační diagram mezi RNA-seq a RNA-amp-seq pro jeden ze dvou provedených replikátů. (B) Dva vzorky embryonálních přípravků odebrané ve dvou časových bodech byly sekvenovány pomocí RNA-seq a RNA-amp-seq. Geny nadměrně zastoupené v embryích středního stadia ve srovnání s časnými embryi hodnocené pomocí RNA-seq jsou v obou grafech zbarveny červeně. Graf vpravo byl vytvořen pomocí měření z metody RNA-amp-seq, což ukazuje, že stejné geny, o nichž je ukázáno, že jsou obohaceny o RNA-seq, také ukazují obohacení metodou amplifikace (červená). Přepisy, které nebyly identifikovány jako nadměrně zastoupené technikou RNA-amp-seq (falešné negativy), jsou také barevné (zelené). (C) Stejné jako pro S1B Obr, ale vykazující transkripty s vyšším výskytem u raných embryí ve srovnání s embryi ve středním stadiu se skutečnými pozitivy (červená) a falešnými negativy (zelená).

S2 Obr. Sdružování blastomerů poskytuje datové sady RNA-seq s nižší variací vzhledem k jednobuněčným metodám [16].

(A) K měření rozptylu byly koeficienty rozptylu vypočítány na základě normalizovaných počtů čtení získaných v naší studii a na základě absolutních molekul mRNA na buňku, jak bylo měřeno v Hashimshony et al. Rozdíly každého genu produkované v každé studii jsou vyneseny proti sobě. Znázorněna je identita x = y (červená plná čára) a dvojnásobná změna integrálů (červeně tečkované čáry). (B) Pomocí normalizovaných měření počtu čtení získaných v této studii jsme vynesli AB přes P1 poměry proti střední intenzitě pro každý transkript (stejný graf jako obr. 1C). Asymetrické transkripty identifikované Hashimshony et al. jsou zvýrazněny modře (obohaceno o AB) a červeně (P1-obohaceno) pro ilustraci jejich chování v naší studii (transkripty identifikované v naší studii jsou uvedeny na obr. 1c). (C) Překrývání mezi geny identifikovanými Hashimshony et al. a naše studie.

S3 Obr. in situ hybridizační obrazy AB-obohaceného, ​​P1-obohacené a symetrické přepisy.

Jsou ukázány transkripty obohacené o AB, které poskytly in situ vzory se skóre 2 nebo vyšším ve slepém průzkumu (vyneseno na obr. 2B). P1-jsou ukázány obohacené transkripty, které poskytly vzory se skóre -2 nebo méně. Je také ukázána podmnožina symetrických přepisů. Přední AB buňka je vždy orientována vlevo od zadní P1 buňka. Červené šipky označují buňku s vyšším pozorovaným signálem. Všechny obrázky v B, C a D byly převzaty z databáze Nematode Expression Data Base (http://nematode.lab.nig.ac.jp/db2/index.php).

S4 Obr. Kvantifikace AB a P smFISH1 přepisy.

chs-1 a bpl-1 ale také pgl-3 vykazoval určité známky asociace částic do větších granulí, které by mohly komplikovat kvantifikaci jednoduchým počtem částic. Jako komplementární přístup jsme změřili a kvantifikovali intenzitu fluorescence normalizovanou pro objem buněk (sečtenou) v částicích a zde ilustrovali jejich množství (B) ve srovnání s měřením hustoty částic (A) které jsou také znázorněny na obr.

S5 Obr. pgl-3 spojuje se pozdějšími buňkami prostřednictvím raných embryonálních stádií.

pgl-3 hybridizační signály mikroskopií smFISH jsou ukázány od 1-buňky do zhruba 22-buněčné fáze vývoje.

S6 Obr Sekvenční znaky spojené s asymetricky hojnými transkripty.

(A) Hledali jsme genové rysy, které odlišují geny obohacené o AB od symetrické sady genů a P1-obohacené geny ze symetrické sady genů. Sekvence, délka a charakteristiky 5 'UTR (Wormbase), 3' UTR anotace (Wormbase, Mangone et al. [100]). použití sestřihu vedoucího (Mangone et al.) a délky sestříhaného a nespojeného genu byly porovnány mezi třemi sadami genů. Nebyly nalezeny žádné statisticky významné asociace kromě délky genového modelu (jak sestřižené, tak nespojené). (B) Jsou ukázány frekvence nukleotidů v celém transkriptu (sestřihový model). (C) Relativní podíl délek sestřiženého mRNA genového modelu (který se pohyboval od 0 do 8 000 nts) je uveden pro P1-obohacené geny a symetrické geny. Geny obohacené o AB a symetrické geny jsou vyneseny do pravého panelu. P hodnoty pro pravděpodobnost, že obě distribuce byly čerpány ze stejné populace, byly vypočteny pomocí Wilcoxonova součtu součtů (Mann Whitney U) test s korekcí kontinuity (P = 1,364x10 -13 pro AB versus symetrické a P = 9,827x10 -9 pro P1 versus symetrický).

Tabulka S1. Přepisy obohacené o AB a P1-obohacené přepisy.

Velmi jednoduchý seznam obohacených o AB a P1-obohacené přepisy identifikované v této studii.

Datová sada S1. AB a P1 soubor transkriptomů.

Soubor aplikace Excel s AB a P1 hodnoty a skóre pro všech 20 240 genů. Tento soubor obsahuje několik pracovních listů. (1) Data anotací. Tento pracovní list uvádí názvy jednotlivých sloupců a jejich význam. Obsahuje také kód R, který byl použit k filtrování a seřazení seznamů. (2) Úplný soubor dat. Tento pracovní list uvádí hrubý počet přečtení na gen pro každý vzorek, normalizovaný počet čtení na gen pro každý vzorek, výstupní analýzu DESeq a anotace každého genu. (2) Současná podmnožina. Jedná se o stejné informace z úplné datové sady, ale zahrnují pouze geny, které jsou „přítomné“. (3) AB podmnožina. Jedná se o stejné informace z úplného datového souboru, ale zahrnuje pouze geny, které byly identifikovány jako obohacené o AB. (4) P1 podmnožina. Jedná se o stejné informace z úplné datové sady, ale zahrnuje pouze geny, které byly identifikovány jako P1-obohaceno. (5) Symetrická podmnožina. Jedná se o stejné informace z úplné datové sady, ale zahrnuje pouze geny, které byly identifikovány jako symetrické. Data z těchto tabulek byla použita ke generování obr. 1C, násobné změny RNA-seq na obr. 2E a S2B obr.

Datová sada S2. Veřejnost in situ hybridizační data.

Soubor aplikace Excel obsahující tři tabulky dokumentující přepisy, které jsme dotazovali v databázi Kohara, a jejich vzorce in situ hybridizace. Data z tohoto souboru byla použita ke generování obr. 2A a 2B.

Datová sada S3. qRT-PCR dokumentace.

Soubor aplikace Excel obsahující měření pro experimenty qRT-PCR. Data z tohoto souboru byla použita ke generování obr. 2C.

Datová sada S4. Embryonální letalita RNAi.

Soubor aplikace Excel obsahující procentuální hodnoty embryonální letality identifikované pro podskupinu obohacených o AB a P1-obohacené geny. Data z tohoto souboru byla použita ke generování obr. 4A.

Datová sada S5. Genová ontologie.

Soubor Excel obsahující ID ontologie GO je nadměrně zastoupeno v obohacených AB a P1-obohacený seznam. Obsahuje termíny GO, výstup REViGO a geny, které přispívají do každé kategorie. Data z tohoto souboru byla použita ke generování obr.

Datová sada S6. Srovnání s publikovanými sadami genů.

Soubor aplikace Excel obsahující seznam všech genů v 7945 přítomných genech. Tento soubor tabeluje ty geny, které se vyskytly v seznamu mRNA mRNA degradovaných z matky [MD] [60], a ty, které se vyskytly v datových sadách obohacených tkáňovým typem [61]. Data z tohoto souboru byla použita ke generování obr. 6A – 6C.

Datová sada S7. Variační koeficient.

Soubor aplikace Excel, který obsahuje počty normalizované podle velikosti, sloučené z tohoto článku a od Hashimshony et al. Součástí jsou výpočty variačního koeficientu a seznam překrývajících se genů. Data z tohoto souboru byla použita ke generování obr. S2A a obr. S2C

Text S1. Rubrika pro hodnocení veřejnosti in situ hybridizační data.

Dokument ve formátu pdf obsahující rubriku použitou k poučení recenzentů, jak hodnotit transkripty, byl dotazován v databázi Kohara a jejich vzorce in situ hybridizace ve 2-buněčné fázi vývoje.

Text S2. sady sond smFISH.

Textový soubor obsahující sondy smFISH použité v této studii. Sondy byly navrženy společností Stellaris. Sondy dokumentované v tomto souboru byly použity ke generování hybridizačních obrazů ukázaných na obr. 3, obr. 5, S4 obr. A S5 obr.

Text S3. Datový soubor kvantitativní mikroskopie.

Textový soubor obsahující počet částic a vnitřní počty fluorescencí pro každé embryo zobrazované sondami smFISH uvedenými v textu S2. Analyzovaná data z této surové sady jsou znázorněna na obr. 3 a S4 obr.

Text S4. PSPM motivu 1.

Textový soubor obsahující matici pravděpodobnosti specifické pro polohu (PSPM) identifikovanou MEME. Tento motiv byl nadměrně zastoupen ve 3 'sekvencích UTR P1-obohacené transkripty vzhledem k sadě 3 'sekvencí UTR symetrických transkriptů.

Text S5. PSPM motivu 2.

Textový soubor obsahující PSPM identifikovaný MEME. Tento motiv byl nadměrně zastoupen ve 3 'sekvencích UTR P1-obohacené transkripty vzhledem k souboru 3 'sekvencí UTR symetrických transkriptů.

Text S6. Experimenty s ředěním RNA.

Textový soubor obsahující surová a normalizovaná čtení pro studii, ve které byly vzorky celkové RNA profilovány jak protokolem s nízkým vstupem RNA-amp-seq, tak standardním protokolem RNA-seq. Data z tohoto souboru byla použita ke generování S1A – S1C Obr.


Podívejte se na video: RNA INTEFERENCE IN Caenorhabditis elegans (Listopad 2021).