Informace

Jak vlastně k mutacím dochází?


Replikace DNA se zdá být tak mechanická- DNA polymeráza právě běžící podél řetězce templátu. Jen nechápu, jak mohou vznikat mutace. Pokud jde o substituce, chápu, že špatný nukleotid se může jen vázat a nebude to tak silná vazba jako u komplementární báze, ale předpokládám, že se to může stát. Pokud však jde o mutace, jako jsou inzerce nebo delece, nechápu, jak by DNA polymeráza mohla přeskočit část DNA nebo přidat další báze. Translokace chromozomů mi také připadá záhadou- téměř jako by buňka věřila, že by měla podstoupit meiózu, ale se spárovanými nesprávnými chromozomy a vyskytuje se pouze u jednoho páru ...

Uvědomuji si, že je to docela široká otázka, ale jakékoli informace o mechanismu, jak k mutacím dochází, by byly velmi ceněny :)


Mutace DNA může být způsobena exogenním nebo endogenním zdrojem. Mnoho vnějších faktorů, jako je ozařování nebo chemikálie, vyvolává mutace. Některé endogenní mutace vznikají z oxidačního stresu, nedostatečné opravy DNA nebo spontánních mutací na molekulární úrovni.

Existuje mnoho mechanismů pro opravu DNA, jako je oprava excize bází, oprava excize nukleotidů, homologní spojení konce nebo nehomologní spojení konce (Löffler, Biochemistry and Pathobiochemistry). Ale pro buňku je obtížnější opravit mutaci, pokud je přítomna v obou řetězcích DNA. Podle vaší druhé otázky:

DNA polymeráza by mohla přeskočit část DNA nebo přidat další báze

DNA polymeráza nemůže rekonstruovat původní vlákno ani orientaci vlákna. Aby se zabránilo buněčné smrti, některé mechanismy opravy DNA zahrnují změnu genomu. DNA polymeráza může přečíst a mutace se replikuje, když se buňka rozdělí. V důsledku toho je klíčovou otázkou, jak účinky mutace ovlivňují schopnost buňky přežít.


Jak vlastně k mutacím dochází? - Biologie

Mutace mohou být pro organismus prospěšné, neutrální nebo škodlivé, ale mutace se „nesnaží“ dodat to, co organismus „potřebuje“. Faktory v prostředí mohou ovlivnit rychlost mutace, ale obecně se nepředpokládá, že by ovlivňovaly směr mutace. Například expozice škodlivým chemikáliím může zvýšit rychlost mutací, ale nezpůsobí více mutací, díky nimž bude organismus vůči těmto chemikáliím odolný. V tomto ohledu jsou mutace náhodné a#151, zda se konkrétní mutace stane nebo ne, nesouvisí s tím, jak užitečná by tato mutace byla.

Například v USA, kde mají lidé přístup k šamponům s chemikáliemi, které zabíjejí vši, máme spoustu vší, které jsou vůči těmto chemikáliím odolné. K tomu existují dvě možná vysvětlení:

Hypotéza A: Hypotéza B:
Rezistentní kmeny vší tu vždy byly — a nyní jsou jen častější, protože všechny rezistentní vši zemřely náhlou smrtí. Vystavení všemu šamponu ve skutečnosti způsobilo mutace v odolnosti vůči šamponu.

Vědci si obecně myslí, že první vysvětlení je správné a že řízené mutace, druhé možné vysvětlení založené na nenáhodné mutaci, není správné.

Vědci provedli v této oblasti mnoho experimentů. Ačkoli výsledky lze interpretovat několika způsoby, žádný jednoznačně nepodporuje cílenou mutaci. Vědci přesto stále provádějí výzkum, který poskytuje důkazy relevantní pro tento problém.

Experimenty navíc jasně ukázaly, že mnoho mutací je ve skutečnosti náhodných a nenastaly, protože se organismus dostal do situace, kdy by mutace byla užitečná. Pokud například vystavíte bakterie působení antibiotika, pravděpodobně budete pozorovat zvýšenou prevalenci rezistence vůči antibiotikům. Esther a Joshua Lederbergové zjistili, že mnoho z těchto mutací na odolnost vůči antibiotikům v populaci existovalo ještě předtím, než byla populace vystavena působení antibiotika —, a že expozice tomuto antibiotiku nezpůsobila výskyt těchto nových rezistentních mutantů.

Lederbergův experiment
V roce 1952 provedli Esther a Joshua Lederbergovi experiment, který pomohl ukázat, že mnoho mutací je náhodných, nikoli zaměřených. V tomto experimentu vytěžili snadnost, s jakou lze bakterie pěstovat a udržovat. Bakterie rostou do izolovaných kolonií na plotnách. Tyto kolonie lze reprodukovat z původního talíře na nové talíře „orazítkováním“ původního talíře látkou a následným orazítkováním prázdných talířů stejným plátnem. Bakterie z každé kolonie jsou zachyceny na tkanině a poté usazeny na nové desky.

Esther a Joshua předpokládali, že kmeny bakterií rezistentních na antibiotika, které přežily po aplikaci antibiotik, měly rezistenci před expozicí antibiotikům, nikoli v důsledku expozice. Jejich experimentální uspořádání je shrnuto níže:

Když je původní destička promyta penicilinem, žijí stejné kolonie (ty v poloze X a Y) —, přestože se tyto kolonie na původní destičce nikdy předtím s penicilinem nesetkaly.


Jak je mutace náhodný proces?

ANO, je pravda, že mutace jsou náhodné, a tak se to může stát kdykoli bez určitého cíle, důvodu nebo vzorce v biologickém těle.

Podle Kimurovy neutrální teorie mají změny v sekvencích DNA uvnitř druhů a mezi nimi jen malý nebo žádný selektivní účinek. Tyto drobné rozdíly vznikly většinou prostřednictvím různých náhodných procesů nazývaných mutace na úrovni nukleotidů (molekulární úroveň DNA).

Je známo, že k mutacím dochází náhodně a pravidelně, a proto je dlouhodobě jedním z klíčových důvodů diferenciace a evoluce v rámci druhu i mezi druhy.

Mutace je ve skutečnosti náhodná a není směrována, protože během buněčného dělení, tj. Buď během mitózy nebo meiózy, nebo během expozice UV záření, replikace viru atd. Dojde během procesu duplikace DNA (genu) k náhodné změně nebo vymazání nukleotidové sekvence .

Během procesu buněčného dělení, tj. Během meiózy v gametických buňkách a mitózy v somatických buňkách, se buňkám během buněčného dělení nejprve duplikuje celá DNA a poté polovina obsahu DNA putuje do jedné dceřiné buňky a půl do druhá dceřiná buňka.

Buňka se tedy vždy snaží dokonale duplikovat. Součástí genomického molekulárního aparátu je enzym DNA polymerázy, který kontroluje proces replikace DNA a zajišťuje správnou duplikaci nového řetězce DNA z řetězce šablony DNA.

Ale přesto v některých případech, kdykoli se buňka rozdělí, dochází příležitostně (zřídka) k malým chybám při kopírování, které nejsou opraveny. Například A (adenin) může být vložen do nového řetězce, spíše než G (guanin).

Také další faktory, jako je vystavení ultrafialovému záření a škodlivým chemikáliím, mohou také způsobit tvorbu volných radikálů, které interagují a oxidují báze DNA. Tyto oxidované báze se během replikace nespárují správně, což způsobuje různé mutace.

Také v důsledku ultrafialového záření může příležitostně dojít k vytvoření dimeru cyklobutan pyrimidinu v segmentech DNA (genomu). Toto se nazývá dimerizační mutace, která brání pyrimidinům v párování bází a také zabraňuje replikaci DNA.

Také víme, že viry nemají stabilní genom DNA nebo RNA, a proto se v důsledku genetické selekce neustále mění. Podstupují jemné genetické změny mutací a velké genetické změny rekombinací.

Když tedy viry infikují tělo vyšších zvířat, replikují částice virové DNA uvnitř tohoto zvířecího genomu, což může příležitostně vést k přímým nebo většinou náhodným mutacím.

Takovým ze všech výše uvedených procesů jsou instance, které se vyskytují zřídka a vedou k náhodným mutacím.

POZNÁMKA: V některých případech je také třeba poznamenat, že tvrzení, že mutace jsou náhodné, je zároveň hluboce pravdivé a zároveň hluboce nepravdivé. Ve většině případů k mutacím dochází náhodně a jsou méně zaměřené (nenáhodné).


Proč není mutace náhodná a přirozený výběr?

Ano, je pravda, že mutace je náhodná, ale přirozený výběr není.

Je to proto, že jeden výskyt mutace může nastat náhodně bez jakéhokoli konkrétního cíle nebo účelu. Zatímco na druhé straně jediný výskyt přirozeného výběru působí na různé mutace, genetické variace genomu vedly k pozoruhodné adaptaci na biologické tělo.

K mutacím může dojít náhodně, zatímco přirozený výběr je řízen mutačními silami, které působí na genom, aby v dlouhodobém horizontu vyvolaly evoluční změny v biologickém těle.

To znamená, že různé druhy mutací se vyskytují po stovky až tisíce let a přirozený výběr je evoluční faktor, který působí po výskytu takových mutací, aby většinu času ukázal, co je prospěšný druh adaptace.

Přirozený výběr selektivně vybírá pouze ty mutace, které pomáhají při přežití a reprodukci potomků, aby se přenesly na další generace. Méně zdatní a nezpůsobilí jsou zničeni.

Genetické varianty způsobené mutacemi, které pomáhají přežít a reprodukovat, se tedy mnohem častěji stanou běžnými než varianty, které tomu tak nejsou.

Abyste lépe porozuměli, můžete považovat přirozený výběr za náhodně se vyskytující, který obsahuje jak náhodné, tak i náhodné složky. V druhém případě jsou však genetické změny (nebo mutace) filtrovány přirozeným výběrem, aby k nim došlo náhodně.


Bakterie učí biology o evoluci

Mikrobi byli původně drženi jako důkaz nezávislosti mutačních procesů a selektivního prostředí. Experiment Luria – Delbruck (1943) prokázal, že před expozicí fágům mohou nastat bakteriální mutace na fágovou rezistenci [2] a Lederbergové vykazovali podobné výsledky na rezistenci na mnoho antibiotik [3]. Objev reakce SOS na poškození DNA a její doprovodné mutageneze [4–7] ve světě molekulární genetiky post-DNA začal erodovat zeitgeistu s náhodnými mutacemi. Harrison Echols si myslel, že reakce SOS znamená „indukovatelnou evoluci“ [8], což odráží podobný návrh Sara inspirovaný Barbarou McClintockovou o adaptaci regulovanými výbuchy nestability genomu [9]. Ale mnozí tvrdili, že SOS mutageneze může být nevyhnutelným vedlejším produktem opravy DNA a je velmi obtížné vyvinout opravu s vysokou věrností. Pozdější návrh Johna Cairnse na „řízenou“ nebo „adaptivní“ mutagenezi při stresu z hladovění Escherichia coli [10, 11] přeformulovali údajnou náhodnost mutace jako vzrušující problém, který ještě nebyl vyřešen. Nyní je známo, že mutageneze, kterou studovali v neletálním prostředí hladovění, odráží stresem indukovanou mutagenezi-mutaci up-regulovanou stresovými reakcemi. Jeho molekulární mechanismus (mechanismy), zde přezkoumané, ukazují regulaci mutageneze. Nyní jsou popsány podobné mechanismy od bakterií k lidem, což naznačuje, že regulovaná mutageneze může být pravidlem, nikoli výjimkou (zde diskutováno a podrobněji přezkoumáno, [12]).

Oprava přerušení mutagenní DNA indukované stresem E. coli

Přerušení dvouřetězcových DNA (DSB) dochází spontánně přibližně u 1% proliferujících E. coli [13, 14]. V nepřízvučném E. coli, Oprava DSB homologní rekombinací (HR) je relativně vysoká věrnost. Aktivace obecné stresové reakce, například hladověním, však přepne přepínač, což způsobí, že se oprava DSB stane mutagenní [15, 16]. Tento proces opravy mutagenních zlomů (MBR) způsobuje mutace přednostně, když jsou buňky špatně adaptovány na své prostředí - když jsou stresované - a, jak ukazuje modelování [17–20], mohou adaptaci urychlit.

Nejméně tři stresové reakce spolupracují na zvýšení mutageneze při hladovění E. coli. Membránová stresová reakce přispívá k tvorbě DSB v některých lokusech [21] SOS odpověď up-reguluje DNA polymerázy náchylné k chybám používané v jednom ze dvou mechanismů MBR [22–24] a obecná stresová reakce licencuje použití nebo perzistenci chyby způsobené těmito DNA polymerázami při opravě DSB [15, 16]. Požadavek na více stresových reakcí naznačuje, že buňky před přepnutím na mutaci zkontrolují několik podmínek prostředí [25]. E. coli MBR je model obecných principů mutace z bakterií na člověka: regulace mutace v čase stresovými reakcemi a její omezení v genomovém prostoru, omezené na malé genomové oblasti, v případě MBR, v blízkosti zlomů DNA. Podíváme se na MBR, pak na další mutační mechanismy v mikrobech a mnohobuněčných organismech, které sdílejí tyto společné rysy.

MBR mechanismy

Při hladovění se vyskytují dva odlišné, ale související mechanismy MBR E. coli, a oba vyžadují aktivaci obecné reakce/hladovění. Navíc se oba vyskytují bez stresu z hladovění, pokud je obecná stresová reakce uměle up-regulována [15, 16], což naznačuje, že samotná stresová reakce bez skutečného napětí je dostačující. Homologně-rekombinační (směrovaná homologií) MBR (HR-MBR) generuje substituce bází a malé indely prostřednictvím chyb DNA-polymerázy během syntézy opravy DSB (obr. 1A – 1F). Mikromhomologní MBR způsobuje amplifikace a další hrubé chromozomální přesmyky (GCR) [26–28], pravděpodobně mikrohomologicky zprostředkovanou replikací indukovanou zlomem (MMBIR) [28, 29] (obr. 1A – 1C, 1G a 1H). Obě cesty MBR zpochybňují tradiční předpoklady o „náhodné“ povaze mutací.

(a – c) Nukleáza RecBCD načítá protein RecA HR na ssDNA, podobně jako základní pár RAD51 načítající lidský BRCA2 s řetězcem identické duplexní DNA (šedý, např. sesterský chromozom). Rovnoběžné čáry, základní páry DNA řetězců. Opravná syntéza (přerušované čáry) je přepnuta na mutagenní režim obecnou stresovou reakcí (sigma S). Chyby DNA polymerázy (d, purpurová X) generují indely (e, purpurová XX) a substituce bází (f, purpurová XX). Mikromhomologní MBR vyžaduje DNA Pol I pro přepínání templátu do oblastí obsahujících mikrohomologii (g), od pouhých několika párů základních párů, a zahajuje replikaci, čímž vytváří přeskupení genomu (h) je zde ukázán duplikovaný segment chromozomu (modré šipky). Kroužkovaná čísla a stínování označují tři hlavní události v HR-MBR: DS DSB a jeho oprava pomocí HR, ② reakce SOS (růžová) a ③ obecná stresová reakce (modrá). Všimněte si, že HR-MBR (d – f, fialová) vyžaduje jak SOS reakci (②, růžová, která up-reguluje DNA Pol IV náchylnou k chybám, nutná pro HR-MBR), tak obecnou stresovou reakci (③, modrá), ale mikrohomologní MBR (g – h, modrá) vyžaduje obecnou stresovou reakci, ale ne SOS (③, modrá). Obrázek upraven z [12]. HR, homologní rekombinace MBR, mutagenní zlomová opravná ssDNA, jednovláknová DNA.

Oba mechanismy MBR jsou iniciovány DSB a vyžadují HR DSB-opravné proteiny (obr. 1, ①) [15, 28, 30–33]. První kroky odrážejí standardní opravu HR DSB: Nukleáza RecBCD zpracovává konce DSB a načítá protein RecA HR (obr. 1A a 1B). Nukleoproteinový filament RecA – DNA může dále aktivovat odpověď SOS (obr. 1, růžová), která je nutná pro HR-MBR, ale nikoli pro mikrohomologní MBR. RecA také usnadňuje invazi vlákna - počáteční kontakt mezi rozbitou molekulou DNA a identickým sesterským chromozomem, ze kterého se provádí templace opravy (obr. 1C). V nestresovaných buňkách vede tento meziprodukt k vysoce přesné opravě HR, pokud je však aktivována obecná stresová reakce, oprava probíhá jednou ze dvou mutagenních drah (obr. 1D – 1H, ③). Při opravě HR-DSB se chyby generované DNA polymerázami IV (DinB), V (UmuDC) a II (PolB) náchylnými k chybám, náchylnými k chybám, hromadí v traktech opravné syntézy během opravy HR (obr. 1D) [22 , 23, 34]. Aktivace obecné reakce na stres licencuje použití těchto polymeráz a/nebo brání odstraňování chyb, které generují: substituce bází a malé indely (obr. 1E, 1F) [35, 36], které se nacházejí převážně v klastrech/hotspotech asi 100 kb kolem původního umístění DSB [30]. Mikromhomologní MBR vyžaduje DNA Pol I, která je navržena tak, aby podporovala mikrohomologicky závislé přepínání templátu během opravné syntézy ke generování GCR (obr. 1G a 1H) [28]. Podobné mechanismy MMBIR jsou navrženy tak, aby byly základem mnoha GCR řízených DSB u lidských genetických chorob a rakoviny [28, 29, 37].

Regulace reakce na stres E. coli MBR

Mechanismy MBR reagující na životní prostředí a časově regulované zpochybňují dlouhodobé předpoklady o konstantní, postupné povaze mutageneze a její slepotě vůči ekologické vhodnosti organismu nebo o jejím nedostatku, což ukazuje, že mutageneze je přísně regulována prostřednictvím environmentálních vstupů. Obecná stresová reakce ovládá přechod mezi vysoce věrnou nebo mutagenní opravou DSB [15, 16]. Tato stresová reakce, řízená alternativním sigma faktorem σ S, se aktivuje mimo jiné hladem, chladem, kyselinou, antibiotiky, oxidačním a osmotickým stresem. Během obecné stresové reakce aktivátor transkripce σ S zvyšuje transkripci stovek genů (přibližně 10% všech E. coli geny), které poskytují řadu ochranných funkcí (přehled, [38]). Nevíme přesně, jak obecná stresová reakce podporuje mutagenezi. Dvě možnosti jsou následující. Za prvé, obecná stresová reakce mírně up-reguluje Pol IV náchylný k chybám nad úrovněmi indukovanými SOS [39]. To může být krok omezující rychlost. Obecná stresová reakce také down-reguluje enzymy opravy nesouladu (MMR) MutS a MutH [40, 41]. Spektrum mutací HR-MBR je podobné spektru nestresovaných kmenů s nedostatkem MMR [35, 36, 42], což naznačuje, že MMR se během HR-MBR přechodně limituje [36, 43, 44]. Další cíle σ S jsou také věrohodné, včetně down-regulace vysoce věrné replikační DNA Pol III. Tato pozorování společně navrhují model, ve kterém obecná stresová odezva umožňuje polymerům náchylným k chybám účastnit se opravy DSB a/nebo umožňuje chybám zavedeným těmito polymerázami uniknout opravě nesouladu.

Alespoň dvě další stresové reakce také přispívají k jednomu nebo oběma mechanismům MBR. Odpověď na poškození SOS DNA je vyžadována u HR-MBR [45], ale ne u mikrohomologních MBR [22].Odpověď SOS je detekována v přibližně 25% buněk s opravitelným DSB [13], a proto přichází automaticky s DSB, který zahajuje MBR. (75% bez SOS se může opravit dostatečně rychle, aby se zabránilo SOS [13].) Reakce SOS zastavuje dělení buněk a aktivuje toleranci poškození a cesty opravy poškození DNA. Primární úlohou reakce SOS v HR-MBR je upregulace DNA polymeráz IV a V náchylných k chybám a případně II. V některých testech produkce Pol IV zcela obnovuje mutagenezi v buňkách defektních SOS [23]. V jiných Pols II a V také přispívají k mutagenezi [16, 34, 46]. A konečně, reakce membránového stresu, regulovaná σ E, podporuje MBR v některých lokusech tím, že hraje roli ve spontánní tvorbě DSB neznámým mechanismem (viz „Lokalizace mutací závislých na MBR“) [21]. Reakce na membránový stres je vyvolána akumulací rozvinutých obalových proteinů způsobenou teplem a jinými stresory [47], a proto se zdá, že tyto stresory spojuje s mutagenezí.

Screening v celém genomu odhalil síť 93 genů potřebných pro MBR vyvolanou hladovým stresem [25]. Je překvapivé, že více než polovina se účastní snímání nebo signalizace různých typů stresu a působí před aktivací klíčových regulátorů reakce na stres, což jsou rozbočovače v síti MBR. Během stresu z hladovění funguje nejméně 31 genů před (při aktivaci) obecné stresové reakce. Většina kóduje proteiny používané při přenosu elektronů a dalších metabolických cestách, což naznačuje, že to mohou být primární senzory stresu z hladovění. Kromě toho je pro aktivaci reakce SOS během MBR vyžadováno alespoň šest genů a pro aktivaci reakce membránového stresu je vyžadováno alespoň 33 genů MBR sítě. 93 MBR genů tvoří vysoce propojenou síť založenou na interakcích protein -protein se třemi regulátory stresové reakce (σ S, RecA/LexA a σ E) jako neredundantní síťové rozbočovače [25]. Síť MBR zdůrazňuje důležitost přísné, kombinatorické regulace stresové reakce mutageneze v reakci na více vstupů.

Obecnost obecné stresové reakce podporované mutace

v E. coliMutageneze závislá na σ S má mutační podpis, který je odlišný od podpisu pozorovaného ve studiích akumulace mutací s nízkým stresem (MA) a mutagenezi závislé na generaci [34, 35, 42, 48]. Důležité je, že existující nukleotidová rozmanitost v genomech E. coli a jiné bakterie jsou lépe popsány podpisem závislým na σ S než podpisem pozorovaným ve studiích MA [48]. Konkrétně jak mutace závislé na σ S, tak mutace pozorované u existujících druhů mají mnohem vyšší poměry přechodů k transverzím, než je vidět v experimentech MA nebo se očekávají náhodou. To naznačuje, že významná část adaptivních mutací v bakteriích pochází z mechanismů mutací indukovaných stresem σ S, jako je MBR [48]. Matematické modelování navíc naznačuje, že mutageneze regulovaná stresovou reakcí, jako je MBR, podporuje adaptaci v měnícím se prostředí [17–20]. Organismy, které kódují regulované mechanismy mutageneze, mohou mít zvýšenou schopnost vývoje, což by podporovalo vývoj a udržování takových mechanismů výběrem druhého řádu [17, 19, 20].

Lokalizace mutací závislých na MBR

MBR generuje mutace v hotspotech v blízkosti místa podněcování DSB, nikoli v náhodných umístěních v genomu [30, 49]. Hotspotting v blízkosti DSB je nejlépe popsán pro HR-MBR iniciované upravenými DSB na různých místech bakteriálního chromozomu [30]. Mutace jsou nejčastější v rámci prvního páru kilobase (kb) na obou stranách DSB a poté spadnou do blízkých úrovní pozadí přibližně 60 kb od přestávky se slabou dálkovou horkou zónou přibližně 1 MB od místa DSB . Tento vzor mutací podporuje model, že většina mutací závislých na MBR vzniká z chyb DNA polymerázy během syntézy opravy HR a zbytek vzniká během procesnější replikace, která je náchylnější k chybám. Pozorování, že k mutacím dochází v blízkosti DSB, samo o sobě nenaznačuje, že by se mutace pravděpodobněji vyskytovaly v určitých genomových oblastech nebo v místech souvisejících s adaptivní „potřebou“ organismu. Naznačuje to však, že distribuce mutací pravděpodobně odráží distribuci DSB a následující řádky důkazů naznačují, že distribuce DSB nemusí být náhodná a odráží potenciální užitečnost genů v konkrétních prostředích.

Zdroje a distribuce spontánních DSB jsou ve všech organismech špatně pochopeny (přehled, [14]), ale máme určité indicie o původu DSB, které vedou k MBR. Za prvé, hybridy transkripční RNA – DNA (smyčky R) jsou jedním ze zdrojů DSB podporujících MBR [50]. R-smyčky se podílejí na tvorbě DSB v mnoha experimentálních systémech, ačkoli přesný mechanismus (mechanismy) rozbití DNA není vyřešen (přehled, [51]). Ačkoli distribuce R-smyček nebyla při hladovění důkladně hodnocena E. coli„R-smyčky bývají zkresleny směrem k vysoce transkribovaným genům, promotorům a genům nekódující RNA [52–54], a mohou proto cílit DSB a mutace na tato místa. Také aktivace odezvy membránového stresu σ E membrány je vyžadována pro tvorbu DSB v některých testech a může se zaměřovat na DSB v genomovém prostoru [21]. Mechanismus, kterým σ E stresová reakce způsobuje DSB, není znám, ale jednou z možností je, že transkripce aktivovaná σ E způsobuje DSB přímo (spíše než prostřednictvím regulace up nebo down genových produktů), prostřednictvím R-smyčky závislé nebo jiný mechanismus závislý na transkripci. R-smyčky a stresová reakce σ E mohou směrovat DSB, a tedy mutace, do oblastí genomu s více adaptivním potenciálem pro dané prostředí: transkribované geny a regulační prvky (promotory a regulační malé RNA).

V klastrech se navíc mohou vyskytovat mutace závislé na MBR [55]. Když dojde k mutaci indukované MBR, je pravděpodobnost nalezení další mutace v sousedních lokalitách vzdálených 10 kb přibližně 10 3krát vyšší, než kdyby k první mutaci nedošlo [55], a to neplatí pro vzdálené nespojené místo v genom [43], což naznačuje, že blízké mutace nejsou nezávislé události. To znamená, že se zdá, že spojené mutace se vyskytují současně, v jednotlivých událostech MBR. Předpokládá se, že takové klastry podporují koordinovanou evoluci současným zavedením změn do více domén proteinu nebo podjednotek komplexního proteinového stroje [15, 20, 55]. Protože ke vzniku nových funkcí je často zapotřebí více mutací a často jsou přechodné mutované stavy méně vhodné a nevybírají se, jak se vyvíjejí složité proteinové stroje, je dlouhodobým problémem [56]. Podobné klastry byly identifikovány v mnoha organismech [57] a v genomech rakoviny, ve kterých se nazývají klastry mutací kataegis, Řecky pro (mutační) bouře [58–60]. Mechanismy lokalizace mutací a společného výskytu odhalené MBR v E. coli vedly mechanističtější porozumění tomu, jak se shluky mutací vyskytují napříč stromem života.

Analýzy E. coli linie akumulace mutací a přirozené izoláty naznačují, že se rychlost místních mutací liší přibližně o jeden řád na stupnici přibližně 10–100 kb [61, 62]. Je možné, dokonce pravděpodobné, že lokalizace mutací závislých na DSB a souběžně se vyskytující klastry mutací charakteristické pro MBR jsou důležitými přispěvateli k této nejednotnosti v rychlosti mutací. Podobné stupně variace v rychlosti místních mutací byly hlášeny u jiných bakterií [63], kvasinek [64] a savců (myší, lidé a další primáti [65, 66]) a mohou také vyplývat z mechanismů mutace podobných MBR. Další analýza přírodních izolátů se specifickým zaměřením na identifikaci shluků kosegregujících jednonukleotidových variant by mohla ukázat, jak časté jsou klastry mutací závislých na MBR a jak tvarují genomy.

Molekulární mechanismy MBR odhalují mnoho způsobů, kterými se mutace nevyskytují v genomickém prostoru rovnoměrně nebo nezávisle na sobě. Je zapotřebí více práce k úplnému posouzení, zda se mechanismus MBR nebo samotné genomy vyvinuly do zkreslených mutací do míst, kde jsou s největší pravděpodobností prospěšné, jako jsou geny aktivně přepisované v reakci na zkušený stresor.


Evoluce reprodukční izolace genetickou mutací

Podle konceptu biologického druhu (Dobzhansky 1937 Mayr 1963) se skupina jedinců nazývá druhem, pokud jsou izolováni od jiných skupin jedinců preminací nebo postmatingem izolačních mechanismů. Je proto důležité vědět, jak je generována reprodukční bariéra na genetické úrovni. V případě polyploidizace je reprodukční bariéra okamžitě generována v samooplodných organismech, protože hybrid nového polyploidu a jeho rodičovského druhu je obecně sterilní, jak je uvedeno výše. Jak však vzniká reprodukční bariéra při absenci chromozomálních přeskupení? Existují různé genetické modely, které mohou vysvětlit vývoj reprodukční izolace. Zde bychom chtěli diskutovat pouze o genetických modelech, které byly studovány empiricky na molekulární úrovni. V praxi má hybridní sterilita nebo inviabilita komplexní charakter a je řízena velkým počtem genů (Coyne 1992) a je obtížné studovat účinek všech těchto genů současně. Většina experimentátorů proto extrahuje malý počet hlavních genů a poté studuje mechanismus reprodukční izolace na molekulární úrovni. Tento přístup je určitě důležitý, ale neměli bychom zapomínat, že může vést k předpojatým závěrům. Všimněte si také, že koncept biologických druhů není vždy použitelný na rostliny nebo houby, protože tyto organismy se často rozmnožují samoopelením nebo asexuální reprodukcí a populace nejsou dobře definovatelné (Rieseberg a Willis 2007). Počáteční reprodukční izolace je také obecně dosažena prezygotickou izolací spíše než postzygotickou izolací. Z tohoto důvodu ke spekulaci dochází snadněji u rostlin a hub než u zvířat.

Během posledních desítek let mnoho vyšetřovatelů použilo takzvaný model Dobzhansky – Muller (DM) (viz níže) jako vodítko pro provádění experimentálních studií a interpretaci jejich výsledků. V praxi je to však pouze jeden z mnoha možných modelů pro vývoj reprodukční izolace, jak bude uvedeno níže.

Dobře, model spekulace duplicitními genovými mutacemi

Jedním z nejjednodušších modelů je Okaův (1953, 1957, 1974) speciační model smrtícími mutacemi vyskytujícími se v duplicitních genech. Werth a Windham (1991) a Lynch a Force (2000), kteří si zjevně nebyli vědomi Okových papírů, navrhli v podstatě stejný model, který je lépe známý ve Spojených státech. V tomto modelu se předpokládá, že se fond základů rozdělí na dvě geograficky izolované populace (populace 1 a 2) a tyto populace se vyvíjejí nezávisle (obr. 4). Předpokládá se také, že původní základová zásoba obsahuje dva duplicitní geny (alely), A0 a B0, které mají nadbytečné funkce a které v alele populace 1 A0 mutuje na smrtící alelu, A1, a v populaci 2 alela B0 mutuje na jinou smrtící alelu, B2 (viz obr. 4). Pokud dojde k těmto evolučním událostem a dojde ke křížení populací 1 a 2, bude hybridní genotyp A0A1B0B2. Tento genotyp bude produkovat gamety A0B0, A1B0,A0B2, a A1B2 každý s pravděpodobností 1/4, pokud jsou dva lokusy odpojeny. Proto jedna čtvrtina (A1B2) z nich budou sterilní.

Dobře, model speciace duplicitními genovými mutacemi. A a B jsou duplicitní geny. A0 a B0 jsou původní normální alely, a A1 a B2 jsou smrtící mutace.

Dobře, model speciace duplicitními genovými mutacemi. A a B jsou duplicitní geny. A0 a B0 jsou původní normální alely, a A1 a B2 jsou smrtící mutace.

Drosophila experimenty ukázaly, že rychlost smrtících mutací na lokus je asi 10 - 5 za generaci. Pravděpodobnost výskytu hybridní sterility by proto nebyla příliš malá. Všimněte si, že rychlost fixace recesivní smrtící mutace v jednom ze dvou duplicitních lokusů je téměř stejná jako rychlost mutace, když jsou efektivní velikosti místních populací relativně malé (Nei a Roychoudhury 1973). Díky těmto úvahám je pravděpodobné, že se reprodukční bariéra vyvine tímto způsobem.

Rozsah sterility gamet se zjevně zvyšuje, když existuje mnoho takových sad duplicitních lokusů. Vlastně když existují n nezávislé sady duplicitních lokusů, které kontrolují tvorbu spermií nebo vajíček, očekávaný podíl sterilních gamet bude 1 - (3/4) n , což se stane 0,9 pro n = 8 a 0,99 pro n = 16. Proto se tento typ sterility gamet pravděpodobně vyskytuje u potomstva nově generovaného polyploidu, kde existuje velké množství duplicitních genů. V posledních letech se však zjistilo, že i nepolyploidní organismy obsahují ve svých genomech velké množství duplicitních genů v malém měřítku (variace počtu kopií) (např. Redon et al. 2006). Proto se model Oka pravděpodobně bude vztahovat prakticky na všechny druhy. V praxi by vztah mezi počtem smrtících genů a rozsahem mužské sterility nebyl tak jednoduchý, jak bylo uvedeno výše. Lynch a Force (2000) navrhli, že funkční divergence duplicitních genů může zvýšit pravděpodobnost výskytu hybridní sterility.

V rýži, Oryza sativa, existují dva tzv. poddruhy Japonica a Indica, která se rozešla asi před 400 000 lety. Tyto poddruhy mají dva duplicitní geny DPL1 a DPL2, které kódují vysoce konzervované malé proteiny specifické pro rostliny a jsou vysoce exprimovány ve zralém prašníku. Mizuta a kol. (2010) to ukázal Japonica nese funkční (DPL1 +) a nefunkční (DPL2 -) alely v DPL1 a DPL2 lokusy, resp. Naproti tomu Indica má nefunkční (DPL1 -) a funkční (DPL2 +) alely na dvou lokusech. Inaktivace alely DPL1 - je způsobeno vložením transpozonu do jednoho z exonů genu, zatímco nefunkčnost DPL2 - je způsobeno mutací A → G v místě sestřihu intronu. Alely DPL1 + , DPL1 − , DPL2 + a DPL2 - odpovídají alelám A0, A1, B0, a B2 na obrázku 4, a tedy částečnou sterilitu hybridu mezi Japonica a Indica lze vysvětlit modelem Oka. Podobná reprodukční izolace způsobená duplicitními genovými mutacemi byla pozorována mezi O. sativa a jemu příbuzné druhy O. glumaepatula (Yamagata et al. 2010). V tomto případě jsou zapojenými geny duplicitní kopie genů S27 a S28 kódující mitochondriální ribozomální protein L27. Ukázalo se, že S27 gen chybí v O. glumaepatula a S28 gen z O. sativa obsahuje nefunkční mutace. Čtvrtina hybridního pylu proto nemá žádný funkční gen, a proto způsobuje pylovou sterilitu. Další příklad tohoto druhu reprodukční izolace byl popsán v Arabidopsis (Bikard et al. 2009, viz tabulka 1).

Ve skutečnosti pomocí klasických genetických technik Oka (1953, 1974) identifikoval řadu genů hybridní sterility, ke kterým zjevně došlo duplicitními genovými mutacemi. V jeho době však nebyly k dispozici žádné molekulární techniky ke studiu evolučních změn genů, a proto jeho závěry zůstaly jen dohady. V tomto smyslu nedávné molekulární studie poskytly solidní empirické důkazy pro jeho teorii. Ve skutečnosti si Oka (1974) byl vědom možnosti starověké polyploidizace rýže na základě cytogenetické studie Sakaie (1935) a Nandi (1936).

V tuto chvíli je třeba poznamenat, že A1 a B2 na obrázku 4 představují smrtící mutace, ale mohou také představovat ztrátu duplicitních genů A0 a B0respektive, protože mají stejný účinek jako smrtící mutace při generování reprodukční izolace. Ve skutečnosti lze tvorbu nových druhů v kvasinkách po duplikaci genomu u jejich rodových druhů (obr. 2 a 3) vysvětlit modelem Oka (Scannell et al. 2006). Je třeba také poznamenat, že většina autorů, kteří studovali hypotézu duplicitní genové mutace, ji mylně nazvala model DM namísto modelu Oka (např. Werth a Windham 1991 Lynch a Force 2000 Mizuta et al. 2010). V modelu Oka jsou příčinnými faktory smrtící mutace nebo ztráty genů a není mezi nimi potřeba interakce A1 a B2. V modelu DM však A1 a B2 jsou funkční geny a zvláštní forma genové interakce mezi alelami A1 a B2 předpokládá se, že existuje, jak bude diskutováno níže. V DM modelu fixace alel A1 a B2 pozitivním výběrem se také často předpokládá.

Někteří autoři nejsou nadšeni z důležitosti Okaova modelu speciace. Coyne a Orr (2004) uvedli, že polyploidizace se u zvířecích druhů nevyskytuje tak často a to minimalizuje význam tohoto modelu. Jak již bylo uvedeno výše, nedávné genomické studie naznačují, že v malém měřítku je duplikace genů hojná a není důvod se domnívat, že model Oka je u zvířat méně důležitý než u rostlin. Coyne a Orr také uvedli, že konečným osudem duplicitních genů je získání nových genových funkcí, nikoli nefunkčnost. Ve skutečnosti je toto tvrzení nesprávné. Duplicitní geny se stávají pseudogeny mnohem častěji, než získávají nové funkce (Lynch a Force 2000 Nei a Rooney 2005). Z těchto důvodů může model Oka hrát důležitou roli ve specializaci u rostlin i zvířat.

DM model evoluce reprodukční izolace

V modelu specializace Oka je nutné mít duplicitní geny. Reprodukční izolaci však lze vyvinout bez duplicitních genů, pokud existují dva nebo více genů, které na sebe vzájemně působí negativně, když jsou spojeny v hybridech. Jedním z takových modelů je takzvaný model DM (Dobzhansky 1937 Muller 1940, 1942). Podstata tohoto modelu je znázorněna na obrázku 5A. Na tomto obrázku jsou dva lokusy, A a Bjsou považovány za a A0A0B0B0 představuje genotyp těchto lokusů v základové zásobě, ze které byly odvozeny populace 1 a 2. Pokud jsou tyto dvě populace geograficky nebo ekologicky izolované, je možné, že ano A0 mutuje na A1 v populaci 1 a tato mutantní alela je v populaci fixována přirozeným výběrem nebo genetickým driftem. Genotyp A0A0B0B0 pak může být nahrazeno A1A1B0B0 bez ztráty životaschopnosti a plodnosti (obr. 5A). Podobně, B0 může mutovat na B2 v populaci 2 a mutantní alela může být fixována. Pokud však existuje genová interakce taková, že jakákoli kombinace mutantních genů A1 a B2 u jednotlivce dochází k inviabilitě nebo sterilitě, hybridy (A0A1B0B2) mezi těmito dvěma populacemi bude invisibilní nebo sterilní. Na obrázku 5A jsme předpokládali, že základový fond měl genotyp A0A0B0B0. Teoreticky je však možné předpokládat, že genotyp předků je A1A1B1B1 a že tento genotyp zůstal v populaci 1 nezměněn, ale změnil se na A2A2B2B2 v populaci 2.

DM model evoluce reprodukční izolace. A0, A1, a A2 představují alely v A lokus, zatímco B0, B1, a B2 představují alely v B místo. (A) Diploidní model. (B) Haploidní (gametový) model.

DM model evoluce reprodukční izolace. A0, A1, a A2 představují alely v A lokus, zatímco B0, B1, a B2 představují alely v B místo. (A) Diploidní model. (B) Haploidní (gametový) model.

Orr (1996) tvrdil, že první osoba, která navrhla model DM, není ani Dobzhansky, ani Muller, ale Bateson (1909) a Batesonův model byl totožný s modelem Dobzhanského a Mullera. Podle našeho názoru je tento argument diskutabilní. Je jistě pravda, že Bateson uvažoval o dvou lokusovém modelu komplementárních genů k vysvětlení hybridní sterility, ale nikdy neuvažoval o tom, jak se takový systém může vyvíjet. Naproti tomu Dobzhansky a Muller vysvětlili evoluční proces genů hybridní sterility, i když velmi hrubě. V evoluční biologii je důležité porozumět procesu evoluce. Z tohoto důvodu budeme v tomto příspěvku tento model označovat jako model DM. Dobzhansky a Muller však předložili pouze slovní argument a nikdy nevysvětlili, proč jen A1 je fixní v populaci 1 a B2 je fixní v populaci 2. Teoreticky je B0B1 mutace může také nastat v populaci 1 a A0A2 v populaci 2 může dojít k mutaci (obr. 5A). Jak je potom jen A1 fixní v populaci 1 a pouze B2 fixní v populaci 2? Dobzhansky i Muller tuto alelu tvrdili A1 může ovlivnit sekundární charakter prostřednictvím pleiotropního účinku a tento účinek může poskytnout selektivní výhodu pro A1 přes A0 v populaci 1. Podobně B2 může mít oproti B0 v populaci 2 kvůli pleiotropnímu účinku.

První matematickou studii tohoto problému provedl Nei (1976). Zde uvedeme shrnutí jeho výsledků. Pro jednoduchost uvažujeme haploidní model uvedený na obrázku 5B místo diploidního modelu, protože oba modely v podstatě dosahují stejného výsledku. Všimněte si také, že haploidní model přímo platí pro plodnost spermatu nebo vajíčka. V haploidním modelu mohou být generovány čtyři možné genotypy pro dvě alely v každém z lokusů A a B, a přiřadíme zdatnost pro čtyři genotypy, jak je uvedeno v tabulce 2. Zde, X a y představují frekvence alel A1 a B2respektive vzhledem k tomu sA a sB jsou selektivní výhody způsobené pleiotropií pro alely A1 a B2, respektive, a t je selektivní nevýhodou genotypu A1B2, který se stane 1, když jsou interpopulační hybridy zcela sterilní. Všimněte si alel A0, A1, B0, a B2 jsou v tomto modelu životně důležité. Zde jsme pro jednoduchost nepředpokládali žádnou nerovnováhu vazeb.

Vhodnost a frekvence čtyř genotypů pro dvě místa neslučitelnosti v haploidním modelu

Vhodnost a frekvence čtyř genotypů pro dvě místa neslučitelnosti v haploidním modelu

Jeden problém zde je, zda alely A1 a B2 mít selektivní výhodu (sA & gt 0 a sB & gt 0) způsobené pleiotropními efekty nebo ne. Obecně lze říci, že je velmi obtížné identifikovat jakýkoli charakter ovlivněný pleiotropními efekty speciačních genů A1 a B2, a i když je identifikován znak, koeficient výběru sA a sB je nepravděpodobné, že zůstanou konstantní po celý proces fixace alel A1 a B2. Nicméně i kdyby sA a sB jsou 0, alely A0 a B0 může být nahrazeno A1 a B2 v populacích 1, respektive 2, vlivem genetického driftu. I v tomto případě pouze A1 nebo B2 musí být stanovena v populaci a průměrná doba výměny bude 1/proti + 2N. generace, kde proti a N. jsou míra mutací a efektivní velikost populace (Nei 1976). Proto to alelám bude trvat dlouho A0 a B0 být nahrazen A1 a B2, resp. I kdyby A1 a B2 jsou vybrány s kladnými hodnotami sA a sB, doba výměny nebude o moc kratší, protože primárně závisí na rychlosti mutace (Li a Nei 1977).

Je třeba také poznamenat, že míra mutací proti se týká pouze těch mutací, které mají selektivní výhodu kvůli pleiotropnímu účinku v populacích, ale vytvářejí silné škodlivé účinky, když jsou spojeny v hybridních jedincích. Nikdo pro tento typ mutací neměřil rychlost mutace, ale ta musí být velmi nízká, protože pouze speciální mutace by byly schopné produkovat takové duální genové efekty. Víme, že model DM je v současné době velmi populární (např. Coyne a Orr 2004), ale existuje jen malý počet experimentálních dat, která model podporují v přísném smyslu (tabulka 1). Orrův (1995) dokument je často citován jako teoretické zdůvodnění modelu. Ve skutečnosti od začátku předpokládal platnost modelu a jednoduše prostudoval možnost kontinuální akumulace genů nekompatibility. Představil si, že reprodukční izolaci vyvíjí pozitivní darwinistický výběr způsobený jejich pleiotropními efekty. To je na rozdíl od modelu Oka, kde se předpokládá, že dochází k reprodukční izolaci v důsledku škodlivých mutací v duplicitních genech.

Podívejme se nyní na některá nedávná experimentální data, která byla považována za podporu modelu DM. První soubor dat, který zvažujeme, je článek Presgraves et al. (2003), ve kterém evoluční změna proteinu jaderných pórů (nukleoporin), Nup96, byl studován v D. melanogaster a D. simulans. Jaderné póry jsou velké proteinové komplexy, které procházejí jaderným obalem a umožňují transport molekul rozpustných ve vodě, jako jsou RNA, DNA polymerázy a uhlohydráty, mezi jádrem a cytoplazmou. Tento jaderný pór se skládá z velké molekulární struktury zvané komplex jaderných pórů, která obsahuje asi 30 různých proteinových složek, každá s více kopiemi (Presgraves a Stephan 2007). Jedním z proteinů je nukleoporin Nup96 a Presgraves et al. (2003) ukázali, že tento protein se podílí na způsobování hybridní mužské inviability mezi těmito dvěma Drosophila druh. K této hybridní inviabilitě došlo pouze tehdy, když D. simulans Nup96 gen je spojen s D. melanogaster Chromozom X. Předpokládali proto, že hybridní inviabilita nastane, když D. simulans Nup96 gen negativně interaguje s jedním nebo více geny genu D. melanogaster Chromozom X. Kromě toho test neutrality McDonald a Kreitman (MK) (1991) naznačil, že Nup96 gen se vyvinul pozitivní selekcí po divergenci těchto dvou druhů. Poté dospěli k závěru, že jejich pozorování podporují DM model speciace a hybridní inviabilita je důsledkem adaptivní evoluce na Nup96 místo. Podobnou studii provedli Tang a Presgraves (2009), kteří identifikovali jiný gen pro nukleoporin, Nup160, zapojený do hybridní mužské inviability mezi těmito dvěma Drosophila druh. Tento gen v D. simulans bylo vyvozeno, že bude negativně komunikovat s D. melanogaster Geny chromozomů X a také s D. simulans Nup96 gen.

S jejich závěry však existuje několik problémů. Za prvé, ve skutečnosti neidentifikovali D. melanogaster Geny chromozomů X, které mají interagovat s D. simulans Nup96 nebo Nup160. Tato identifikace je zásadní, protože jinak nevíme, jak interakce mezi těmito dvěma geny vede k hybridní mužské inviabilitě. Geny chromozomů X teoreticky nemusí být geny kódující proteiny, ale heterochromatin, který se často podílí na hybridní inviabilitě (např. Ferree a Barbash 2009, viz níže). Za druhé, Presgraves a jeho kolegové získali podpis pozitivního výběru pro zvýšení frekvence Nup96 a Nup160 pomocí testu MK. Test MK však závisí na řadě zjednodušujících předpokladů a může dojít k chybným závěrům, pokud tyto předpoklady nejsou splněny (Nei et al. 2010).

Proto jsme zkoumali rozsah pozitivní selekce pomocí modifikované metody Nei-Gojobori (Zhang et al. 1998) srovnání sekvence DNA. V této metodě je poměr počtu nesynonymních nukleotidových substitucí na místo (dN.) na synonymní nukleotidové substituce (dS) se vypočítá a rozsah pozitivního výběru se měří pomocí dN. /dS. Li dN. /dS je větší než 1, navrhuje se pozitivní výběr, zatímco dN. /dS & lt 1 znamená negativní nebo purifikační výběr. Tato analýza nám navíc říká, zda se geny nukleoporinu vyvíjejí rychleji než jiné geny, jak často tvrdí Presgraves a další. Když jsme vypočítali tento poměr pro Nup96 a Nup160 za použití D. melanogaster a D. simulans sekvencí, jsme získali pouze 0,19, respektive 0,25. Tyto hodnoty naznačují, že se tyto dva geny mezi 5314 zkoumanými geny nevyvinuly zvlášť rychle (v průměru 0,16) a pravděpodobně podléhají purifikační selekci (obr. 6).

Distribuce dN./dS poměr mezi Drosophila melanogaster a D. simulans geny. Celkem 5 314 genů kódujících protein, které mají mezi 12 ortology jeden k jednomu Drosophila byly použity druhy. The dN. a dS hodnoty byly vypočítány modifikovanou metodou Nei-Gojobori (Zhang et al. 1998) s poměrem přechod/transverze 2.

Distribuce dN./dS poměr mezi Drosophila melanogaster a D. simulans geny. Celkem 5 314 genů kódujících protein, které mají mezi 12 ortology jeden k jednomu Drosophila byly použity druhy. The dN. a dS hodnoty byly vypočítány modifikovanou metodou Nei-Gojobori (Zhang et al. 1998) s poměrem přechod/transverze 2.

Zde však není důležité vědět, zda došlo k pozitivní selekci nových alel, ale pochopit, jak tyto geny generují hybridní inviabilitu. Někdo může tvrdit, že pozitivní výběr je důležitý, protože by urychlil proces speciace. Ve skutečnosti není nutné, aby jakýkoli organismus měl rychlou speciaci. K reprodukční izolaci dochází pouze jako důsledek obecnější evoluční změny morfologických nebo fyziologických znaků, a proto musí jít o pasivní proces, jak zdůraznil Darwin (1859, s. 245).

Existuje však několik datových sad, které model DM zjevně podporují. Long a kol. (2008) zjistili, že dvojice těsně spojených lokusů SaF a SaM v rýži obsahují různé alely v poddruzích Japonica (SaF - a SaM -) a Indica (SaF + a SaM +) a samci jejich kříženců jsou sterilní. Gen SaF kóduje protein F-boxu podílející se na degradaci proteinu, zatímco SaM produkuje malý ubiquitin podobný modifikátor E3 ligázu podobný protein. Protein kódovaný SaF je dlouhá 476 aminokyselin a mezi alelami je pouze jeden rozdíl aminokyselin SaF + a SaF -. Naproti tomu SaM + a SaM - kódují proteiny s 257 aminokyselinami, respektive 217 aminokyselinami, přičemž poslední z nich je zkrácený protein. Alely SaF + a SaM + v Indica jsou považovány za rodové geny a SaF - a SaM - jsou považováni za mutanty generované v procesu vývoje Japonica (obr. 7). Haplotyp SaFSaM + který se nachází v Indica může být předchůdcem haplotypu SaF - SaM - v Japonica. Hybridizuje oba s Indica a Japonica bez problémů (obr. 7). Pokud tomu tak je, tento haplotyp představuje mezistupeň v procesu vývoje SaFSaM - v Japonica. Tyto evoluční změny SaF + Sam + na SaF - SaM - jsou v souladu s modelem DM. Molekulární základ genové interakce za účelem vytvoření hybridní sterility je však stále neznámý.

Samčí sterilita způsobená různými kombinacemi alel v SaF a SaM loci v rýži. Upraveno z Long et al. (2008).

Samčí sterilita způsobená různými kombinacemi alel v SaF a SaM loci v rýži. Upraveno z Long et al. (2008).

Další datová sada, která podporuje model DM, je Chou et al. (2010), který studoval dvojici genů způsobujících F2 sterilita mezi kvasinkami S. cerevisiae a S. paradoxus. Studované geny jsou jaderně kódovaný gen pro sestřih mitochondriální RNA (MRS1) a mitochondriemi kódovaný gen cytochrom oxidázy 1 (COX1). v S. paradoxus, introny COX1 jsou správně sestaveny samostatně MRS1. v S. cerevisiae, ale jeden (M1) z intronů byl ztracen COX1. Tato mutace byla s největší pravděpodobností neutrální, protože ztráta intronu neovlivnila genovou nebo proteinovou funkci COX1. Následně se MRS1 ztratil svou spojovací funkci, která se také zdá být neutrální. Hybridy mezi těmito dvěma druhy však vykazují sterilitu, protože MRS1 protein v S. cerevisiae nelze spojit intron M1 COX1 z S. paradoxus. Toto schéma evoluce reprodukční izolace je v souladu s DM modelem a v tomto případě je pravděpodobné, že k evolučním změnám genů došlo především mutací a genetickým driftem. Byla popsána podobná evoluční změna, která vysvětluje hybridní sterilitu způsobenou AEP2 a OLI1 geny mezi S. cerevisiae a S. bayanus (Lee et al. 2008, viz tabulka 1).

Existuje mnoho dalších dokumentů, které tvrdily, že podporují model DM (Coyne a Orr 2004 Wu a Ting 2004, viz tabulka 1). Bližší zkoumání příspěvků však naznačuje, že autoři často nepochopili koncept modelu nebo je ukázka neúplná. Proto jsou zapotřebí pečlivější studie o genech uvedených v těchto dokumentech (tabulka 1). Všimněte si, že i když některé geny zcela následují model DM, nemusí mít nic společného se specifikací, ale prostě se staly nekompatibilními jednoduše jako vedlejší produkt druhové divergence.

Multiallelic Complementary Genes Model

Nei a kol. (1983) navrhli rozšířenou verzi modelu DM, aby vysvětlili druhově specifickou genovou kompatibilitu a další reprodukční izolaci. Jako konkrétní příklad uvažujme evoluční změny spermatického proteinu lysinu a jeho vaječného receptoru VERL u druhů mušlí. V abalone jsou vajíčka uzavřena vitellinovým obalem a spermie musí do této obálky proniknout, aby oplodnilo vajíčko (Shaw et al. 1995). Receptor VERL pro lysin je dlouhý kyselý glykoprotein složený z 22 tandemových opakování 153 aminokyselin a asi 40 molekul lysinu se váže na jednu molekulu VERL (Galindo et al. 2003). Interakce mezi lysinem a VERL je druhově specifická, a proto tento pár proteinů zjevně kontroluje druhově specifické páření. Obrázek 8 ukazuje genetický model vysvětlující druhovou specificitu mezi lysinovými a VERL geny. V rámci druhu (druh 1 nebo 2) jsou geny lysinu a VERL kompatibilní, takže k páření dochází volně. Pokud jsou však hybridizovány druhy 1 a 2, lysin a VERL jsou nekompatibilní, a proto je hnojení blokováno. To zaručuje druhově specifické páření, když jsou tyto dva druhy smíchány.

Model druhové specificity rozpoznávání gamet mezi lysinem a VERL v abalone. Upraveno z Nei a Zhang (1998).

Model druhové specificity rozpoznávání gamet mezi lysinem a VERL v abalone. Upraveno z Nei a Zhang (1998).

Vyrobit gen pro druh 2 z genu pro druh 1 nebo genů pro druh 1 a 2 z jejich společných rodových genů jednoduchou mutací v lysinových a VERL lokusech není příliš jednoduché, protože mutace (AAk) na lysinovém lokusu činí lysinový gen neslučitelným s alelou divokého typu (B) na VERL lokusu. Mutace (BBk) na lokusu VERL má také za následek nekompatibilitu s alelou divokého typu (A) na lysinovém lokusu. Tyto mutace by proto v populaci nezvyšovaly frekvenci. Samozřejmě, pokud jde o mutace AAk a BBk se vyskytují současně, lysin Ak a VERL Bk může být kompatibilní. Šance, že by se tito mutanti ve velké populaci navzájem setkali, by však byla velmi malá.

Z tohoto důvodu Nei a kol. (1983) a Nei a Zhang (1998) navrhli evoluční změnu alely A (nebo B) do Ak (nebo Bk) nastává prostřednictvím intermediálních alel a že blízce příbuzné alely mají podobné funkce, a proto jsou kompatibilní. Například, A může nejprve mutovat Aj a potom do Ak, zatímco B může mutovat na Bj a potom do Bk. Předpokládat A je kompatibilní s B a Bj ale ne s Bk a B je kompatibilní s A a Aj ale ne s Ak. Li Aj je kompatibilní s B, Bj, a Bk a pokud Bj je kompatibilní s A, Aj, a Akpak je možné generovat druhově specifickou kombinaci alel v lysinových a VERL lokusech u každého druhu ( a k(v uvedeném pořadí) prostřednictvím mutace a genetického driftu bez pozitivní selekce, kterou model DM často předpokládá.

Existuje několik dalších příkladů inkompatibility ligandových a receptorových genů zapojených do oplodnění nebo reprodukce. Protein bindin z mořského ježka například zprostředkovává oplodnění spermatu k vajíčku. Receptor bindinu se nazývá EBR1 a jeho interakce s bindinem je druhově specifická (Kamei a Glabe 2003). U savců hraje protein nazývaný ADAM2 (nebo fertilin β) roli spermatického ligandu pro receptory membrán vaječné plazmatické membrány, integriny (Evans a Florman 2002 Desiderio et al. 2010), a interakce mezi těmito proteiny se zdají být druhově specifické. Interakce protein -protein v různých biochemických procesech nezbytných pro vývoj a fyziologii je také často komplementární. Podobně kontrola exprese genů kódujících protein pomocí cis-regulační prvky se svou povahou doplňují.

Nei a kol. (1983) vyvinuli několik modelů evoluce reprodukční izolace pomocí multiallelických genů komplementarity. Zvažovali modely s jedním lokusem i dva lokusy. Předpokládalo se, že k mutaci dochází buď po modelu postupném, nebo podle modelu nekonečné alely (Kimura 1983), a vhodnost genotypu se předpokládá buď 1 nebo 0 v závislosti na modelu mutace a generovaném genotypu (obr. 9). Uvažovalo se také o izolaci prematingu a postmatingu. Jejich závěry jsou shrnuty následujícím způsobem. 1) Model s jedním lokusem generuje speciaci rychleji než model se dvěma lokusy. 2) Model s nekonečnými alelami generuje speciaci rychleji než model s postupnými mutacemi. 3) S použitým epistatickým genovým modelem (obr. 9) dochází k vývoji reprodukční izolace rychleji v malých populacích než ve velkých populacích. 4) Obecně řečeno, doba do výskytu speciace je velmi dlouhá a je zhruba úměrná inverzní rychlosti mutace.

Model postupných mutací pro geny hybridní sterility (nebo inviability). (A) V modelu postupných mutací může dojít k dopředné a zpětné mutaci. (B) Plodnost pro různé haplotypy pro lokusy A a B (model se dvěma lokusy) a genotypy pro lokus A (model s jedním lokusem) je dán 0 (neplodný) nebo 1 (plodný). Vzdáleně příbuzné haplotypy nebo genotypy jsou neplodné.

Model postupných mutací pro geny hybridní sterility (nebo inviability). (A) V modelu postupných mutací může docházet k dopředné a zpětné mutaci. (B) Plodnost pro různé haplotypy pro lokusy A a B (model se dvěma lokusy) a genotypy pro lokus A (model s jedním lokusem) je dán 0 (neplodný) nebo 1 (plodný). Vzdáleně příbuzné haplotypy nebo genotypy jsou neplodné.

Tyto výsledky jsou však závislé na modelu a výsledky nemůžeme použít na přirozené populace bez kvalifikace. Například model s jedním lokusem, který bude zvažován níže, může být použitelný pouze pro určité znaky, jako je doba květu v rostlinách a doba vývoje u zvířat. V současné době také nevíme, který ze stupňovitých a nekonečně alelových modelů je realističtější než ten druhý, i když se domníváme, že druhý model je realističtější, protože reprodukční izolace je řízena velkým počtem genů ovládajících různé fenotypové znaky. Naše výsledky naznačují, že ke spekulacím dochází rychleji díky úzkým místům. Tento závěr je v souladu s Mayrovou (1963) teorií zakladatelského principu, která byla kritizována mnoha autory (např. Coyne a Orr 2004). Studie Nei et al. (1983) byla provedena pomocí specifických matematických modelů epistatické genové interakce, na rozdíl od Mayrova verbálního argumentu bez jakéhokoli genetického modelu. To by také znamenalo, že samooplodné organismy mohou procházet rychlejší evolucí než náhodné pářící se populace.

Obecně se však speciace vyskytuje velmi pomalu a trvá miliony až desítky milionů let, než se vyvinou dobře zavedené druhy (Coyne a Orr 2004, s. 419–421). To naznačuje, že závěr Nei a kol. O době speciace nemusí být tak nereálný.

Mutačně-záchranný model spekulace

Jedním příkladem hybridních genů inviability, které jsou často uváděny jako podpora modelu DM, jsou geny pro tvorbu melanomu u druhů ryb patřících do Xiphophorus (Orr a Presgraves 2000 Orr a kol. 2004 Wu a Ting 2004). Hybridy mezi druhy tohoto rodu často produkují maligní melanom. Tento nádor se vyvíjí, když se provádí určitý typ křížení experimentů a jeden z nich je uveden na obrázku 10. Na tomto obrázku je X + a X - představují přítomnost a nepřítomnost tumorigenního genu Xmrkrespektive vzhledem k tomu R. + a R. - označují přítomnost a nepřítomnost regulačního genu (R.), resp.

Typické křížení experimentů v Xiphophorus druh. X + a X - představují přítomnost a nepřítomnost souboru Xmrk gen. R. + a R. - představují přítomnost a nepřítomnost souboru R. gen. F1 kříženci (X + X − , R. + R. -) vyjadřují benigní melanom, ale jsou na tomto obrázku zobrazeny s normálním typem. Jedna čtvrtina potomků zpětného křížení vyvine melanom. Upraveno podle Schartl (2008).

Typické křížení experimentů v Xiphophorus druh. X + a X - představují přítomnost a nepřítomnost souboru Xmrk gen. R. + a R. - představují přítomnost a nepřítomnost souboru R. gen. F1 kříženci (X + X − , R. + R. -) vyjadřují benigní melanom, ale jsou na tomto obrázku zobrazeny s normálním typem. Jedna čtvrtina potomků zpětného křížení vyvine melanom. Upraveno podle Schartl (2008).

Gen Xmrk je duplicitní kopií genu pro receptor epidermálního růstového faktoru a získala schopnost generovat melanom. Tento gen je však exprimován pouze tehdy, když je supresorový gen R. v genomu chybí. Proto ten druh s geny Xmrk a R. (X. maculatus na obr. 10) nevykazuje melanom. Podobně druhy bez č Xmrk a R. geny (X. heller) neobsahuje melanom. Genotyp (X + XR.R. -) s jedním Xmrk gen, ale ne R. gen u potomků zpětného křížení vyvíjí rakovinu melanomu (Schartl 2008). Pokud tento genotyp vykazuje nízkou kondici, může dojít k reprodukční izolaci.

Genetický základ této hybridní inviability je však velmi odlišný od genetického modelu DM. Všimněte si, že genotypy (X + XR. + R. -) a (XXR. + R. -) jsou normální, na rozdíl od modelu DM. V tomto případě mutantní gen Xmrk je ze své podstaty škodlivý (obr. 10), ale u každého druhu je jeho škodlivý účinek snížen R. gen. Tohle znamená tamto Xmrk (X +) je škodlivá mutace a R. + zachraňuje škodlivý účinek mutace a tím i jedinců s geny X + a X + stát se normálním. Tento hybridní systém neschopnosti proto nazýváme modelem záchrany mutací. S vědomím, že škodlivý účinek genu X + o kondici není ve své podstatě vážné, Schartl (2008) zpochybňuje relevanci tohoto systému pro speciaci. Rádi bychom však tento systém použili jako příklad modelu záchrany mutací s očekáváním, že podobné příklady budou pravděpodobně v budoucnu nalezeny.

V současné době existuje několik datových sad, které lze vysvětlit modelem záchrany mutací, ale nejsou tak jednoduché jako ve výše uvedeném příkladu. V rostlinách existuje mnoho příkladů cytoplazmatické samčí sterility (CMS) (např. Zeh JA a Zeh DW 2005 Chase 2007 pro recenze) a věří se, že hybridní sterilita způsobená CMS nastává, když některé specifické cytotypy, pravděpodobně specifické mitochondriální geny, interagovat s jadernými geny (cytonukleární genová interakce). Je zajímavé, že některé mutantní alely jaderných genů mohou zachránit mužskou plodnost, ačkoli molekulární základ této záchrany není dobře znám. Například v křížení dvou druhů opic, Mimulus guttatus a M. nasutusCase a Willis (2008) ukázali, že gen zapojený do CMS je jedním z otevřených čtecích rámců, které jsou kotranskribovány mitochondriálním genem NADH dehydrogenázy (NAD6), zatímco Barr a Fishman (2010) ukázali, že jaderným záchranným prvkem jsou geny patřící do velmi velké genové rodiny nazývané rodina opakování pentatrikopeptidu (PPR). Počet genových kopií této rodiny se v rostlinách nesmírně rozšířil a Arabidopsis má ~ 450 PPR genů roztroušených po celém genomu (Lurin et al. 2004). Funkce této rodiny genů není dobře známa, ale bylo předpovězeno, že asi polovina proteinů PPR je zaměřena na mitochondrie (Chase 2007) a několik autorů uvádí geny PPR jako záchranné geny (tabulka 1). Je však záhadou, jak tato velká genová rodina interaguje s prvky CMS za účelem snížení škodlivých účinků mitochondriálních mutací. Navíc v těchto studiích nebyl zkoumán evoluční proces mitochondriálních a jaderných genů, takže není jasné, zda tento systém opravdu vyhovuje modelu záchrany mutací. Očividně je nutná podrobnější studie. Zdá se, že molekulární studium tohoto systému je dokonce za studiem modelu segregačního distorčního genu, o kterém bude pojednáno níže.

Segregační zkreslovače a specializace

V diploidních organismech mužský heterozygot (Aa) pro lokus produkuje dva různé druhy spermií (A a A) se stejnou frekvencí. Existují však geny, které zkreslují mendelovský poměr segregace v jejich prospěch, takže jejich frekvence ve spermiích je mnohem vyšší než 50% (někdy téměř 100%). Tyto geny se nazývají narušovače segregace (D - ). K segregačnímu zkreslení dochází, protože distorterový gen ničí vysoký podíl chromozomů nesoucích opačnou alelu v procesu spermatogeneze (Hartl 1969 Wu a Hammer 1991 Kusano et al. 2003). Zkreslený gen se často nachází na chromozomu X, a proto je poměr pohlaví u potomků zkreslený (Presgraves 2008). Protože tito muži produkují více spermií s chromozomem X než spermie s Y, bude zde více ženských potomků než mužských potomků a tento zkreslený poměr pohlaví je pro tento druh nevýhodný. Kromě toho jsou samotné distorzní geny často škodlivé, ale jejich frekvence se mohou drasticky zvýšit segregačním zkreslením.

Zajímavé je, že výraz D - geny jsou často potlačovány supresorovými geny (S - ). Pokud tedy dojde k nové zkreslené mutaci (D - ) se vyskytuje v populaci, její frekvence by se zpočátku rychle zvyšovala kvůli zkreslení segregace navzdory jejím škodlivým účinkům. Toto zvýšení frekvence však lze zastavit, pokud dojde k nové supresorové mutaci (S - ) vzniká a potlačuje škodlivý účinek D - gen. The D - a S - geny pak mohou být současně fixovány v druhu. Po fixaci těchto mutací nedojde k žádnému segregačnímu zkreslení a žádným škodlivým účinkům D - gen (Wu et al. 1988 Frank 1991 Lyttle 1991 Tao et al. 2001 Phadnis a Orr 2009).

Pokud však tento nový druh s mutantními geny D - a S - je křížen se svými sourozenci s alelami divokého typu D + a S + , účinek D - se může znovu objevit v F1 hybridy, pokud S - není dominantní nad S + nebo v F2 hybridy, pokud D - je rekombinován s S + a genotypy D - D - S + S + nebo D - D + S + S + jsou vyráběny (Frank 1991 Hurst a Pomiankowski 1991 Tao et al. 2001). Pokud tyto události sníží kondici hybridních jedinců, vytvoří nový způsob vytváření reprodukčních bariér mezi těmito dvěma druhy. Genetická povaha supresorových genů není dobře známá. Nicméně v případě Distributor segregace (D - ) haplotyp poprvé publikoval Sandler et al. (1959) v D. melanogaster, S lokus (Odpovědník) sestává z velkého počtu asi 120 bp opakování a bylo ukázáno, že segregační zkreslení sílí, jak se počet opakování zvyšuje, a že když supresorový lokus obsahuje malý počet opakování, nedojde k žádnému segregačnímu zkreslení (Wu et al. 1988).

D - geny jsou přítomny na autosomálních chromozomech i na Y, ale zdá se, že jsou méně časté než na chromozomu X, jak diskutovali Frank (1991) a Jaenike (2001). Toto pozorování poskytuje vysvětlení pro Haldanovo pravidlo (1922), které říká, že když jsou kříženy dva druhy nebo poddruhy, heterogametické pohlaví s chromozomy XY nebo ZW je sterilní nebo invisibilní častěji než homogametické pohlaví s chromozomy XX nebo ZZ (Frank 1991 Hurst a Pomiankowski 1991).

U hmyzu, savců a rostlin byly hlášeny desítky zkreslených genů, ačkoli molekulární základ zkreslení není dobře znám (Jaenike 2001). v D. simulans, nejméně tři D - lokusy byly identifikovány a každý S - lokus odpovídá každému D - lokus (Presgraves 2008). V těchto případech je však molekulární mechanismus funkce S - loci je nejasný.

Hybridní neschopnost spojená s heterochromatinem

Řada vyšetřovatelů (např. Henikoff a Malik 2002 Brideau et al. 2006 Bayes a Malik 2009) uvedli, že opakované prvky DNA v heterochromatinových oblastech genomů jsou často spojeny s hybridní sterilitou nebo inviabilitou. Jedním ze zajímavých pozorování je hybridní sterilita způsobená hybridní záchrana zygoty (Zhr) lokus dovnitř Drosophila. Když D. simulans samice jsou zkříženy s D. melanogaster samci, hybridní samice hynou na počátku embryogeneze. Mutantní alela (Zhr 1) ze dne Zhr je známo, že zachraňuje životaschopnost žen (Sawamura et al. 1993). Ferree a Barbash (2009) ukázali, že alela divokého typu Zhr představuje oblast 359 nukleotidových opakování v D. melanogaster X chromozom, které interagují s některými cytoplazmatickými faktory D. simulans. Počet 359 opakování nukleotidů je malý D. simulans, takže plodnost v tomto druhu je vysoká. v D. melanogaster„Počet opakování DNA je vysoký, ale tento druh také vykazuje vysokou plodnost, protože cytoplazmatické faktory se liší od faktorů D. simulans. V současné době však cytoplazmatické prvky nebyly identifikovány, a proto molekulární základ interakce mezi DNA a cytoplazmatickými faktory zůstává nejasný. Přesto se zdá, že počet opakování DNA je druhově specifický a může se relativně rychle měnit v důsledku koordinovaného vývoje nebo vývoje narození a smrti (Henikoff a Malik 2002). Ačkoli je málo známo o evolučním mechanismu cytoplazmatických prvků, je možné, že se opakují jak DNA opakující se prvky, tak cytoplazmatické faktory, jako v případě modelu více lokálních komplementárních genů se dvěma lokusy diskutovaného dříve.

Dalším příkladem je homeobox Odysseus (OdsH) gen, který způsobuje hybridní samčí sterilitu, když D. mauritiana samice jsou zkříženy s D. simulans muži (Ting et al. 1998 Sun et al. 2004). V tomto případě není receptor pro tento gen transkripčního faktoru dobře definován. Nedávno však Bayes a Malik (2009) zjistili, že OdsH protein vyrobený z D. mauritiana lokalizuje do heterochromatického chromozomu Y z D. simulans ale OdsH protein z D. simulans ne. Poté navrhli, aby nadměrné vyjádření OdsH protein v heterochromatinu Y je zodpovědný za mužskou sterilitu. Molekulární mechanismus interakce však opět zůstává nejasný. Zdá se, že podobný mechanismus funguje s Prdm9 gen u myší (Oliver et al. 2009, viz tabulka 1).

Specifikace jednoho zaostření

Často se uvádí, že reprodukční izolaci nelze dosáhnout mutacemi na jednom lokusu, protože škodlivou mutaci vyskytující se na lokusu nelze zafixovat v žádné populaci. Pokud se však na lokusu vyskytují multiallelické mutace, které jsou navzájem kompatibilní, když jsou v blízkém vztahu, ale mutantní alely se stanou nekompatibilními, když jsou vzdáleně příbuzné, může dojít k vytvoření hybridní sterility nebo inviability na jednom lokusu. Obrázek 9 ukazuje jeden takový příklad, kde alela A0 je kompatibilní s alelou A−1, A0, a A1 ale ne s jinými alelami (alely v místě ignorujte B). Tedy genotyp A2A2 není kompatibilní s genotypem A0A0 buď v párovací schopnosti, nebo zygotické životaschopnosti nebo sterilitě. Dvě populace složené z A0A0 a A2A2 jedinci pak budou reprodukčně izolovaní.

V rýži existuje jeden příklad, který podporuje tento model na molekulární úrovni. Reprodukční bariéra mezi Indica a Japonica je řízen mnoha geny. Jedním z nich je S5 gen, který kóduje aspartátovou proteázu určující plodnost embryonálního vaku. Protein kódovaný tímto genem v Indica (S5i) a Japonica (S5j) se liší na dvou místech aminokyselin (Chen et al. 2008). Jeden z těchto rozdílů (F273L) v Japonica Zdá se, že je zodpovědný za sterilitu hybridu mezi Indica a Japonica. Zajímavé však je, že existují kmeny, které produkují plodné hybridy jak s Indica a Japonica. The S5 gen (S5n) v těchto kmenech kóduje protein s delecí fragmentu 115 aminokyselin, a to mohla být mezilehlá alela mezi S5i a S5j. Tento typ speciace jednoho lokusu je hodnověrný zejména u samooplodných organismů, jako je rýže.

Izolace reprodukce jednotlivými lokusy může také nastat pomocí mutací kontrolujících dobu květu v rostlinách. K tomu by snadno došlo u samooplodných rostlin. Na molekulární úrovni je doba květu řízena velkým počtem lokusů, z nichž mnohé jsou duplicitní geny. Dobu květu ovlivňují také faktory prostředí, jako je fotoperiodicita a vernalizace. V posledních letech bylo identifikováno mnoho genů zapojených do regulace doby květu Arabidopsis (Simpson et al. 1999 Boss et al. 2004 Pouteau et al. 2008). Ačkoli je doba květu řízena mnoha geny, jedna mutace může drasticky změnit dobu květu a může způsobit reprodukční izolaci. Jedním ze zajímavých případů je mutace, ke které došlo v kvetoucí lokus (FLC), represor kvetení zapojený do cesty vernalizace. Genomy Brassica druhy obsahují několik FLC paralogní geny. Yuan a kol. (2009) zjistili, že jeden z FLC geny, FLC1 v Brassica rapa, je polymorfní s ohledem na dobu květu v přírodě a tento polymorfismus je způsoben mutací místa sestřihu (G → A) v intronu 6. Tato mutace pak ukázala, že mění dobu květu. K reproduktivní izolaci v důsledku heterogenity ve vývojovém čase dochází také u hmyzu (Tauber CA a Tauber MJ 1977). Molekulární základ evoluce tohoto typu reprodukční izolace však nebyl zkoumán.

Další mechanismy evoluce reprodukční izolace

Existuje mnoho dalších speciačních modelů, které jsou založeny na relativně malém počtu pozorování nebo jejichž teoretický základ je nejasný. Transpozice genu může například také způsobit hybridní inkompatibilitu. Masly a kol. (2006) ukázali, že JYAlpha gen kódující alfa podjednotku Na + a K + adenosintrifosfatázy byl transponován z chromozomu 4 do chromozomu 3R v D. simulans po divergenci od D. melanogaster. V důsledku toho, když jsou tyto dva druhy kříženy, některé z nich F2 jednotlivci nemají žádnou kopii JYAlpha v genomu a stanou se sterilními. Jedná se o speciální případ klasické reciproční translokace chromozomů, o kterém jsme hovořili dříve. Transpozice nebo translokace genu však může nastat častěji než chromozomální translokace, jednoduše proto, že v genomu je více genů než chromozomů a transpozony mohou zprostředkovat přenos genů. Několik autorů (Henikoff a Malik 2002 Brown a O'Neill 2010) navrhli, že rychlá koordinovaná evoluce opakujících se prvků DNA v centromerickém chromatinu může generovat speciaci narušením chromozomální segregace. Logika tohoto argumentu není příliš jasná, ale je zajímavé poznamenat, že opakující se prvky jsou často zapojeny do hybridní sterility a inviability. Je třeba také poznamenat, že epigenetické faktory řídící fotoperiodicitu a vernalizaci v rostlinách jsou zjevně zapojeny do speciace, ačkoli molekulární studium těchto problémů je stále v plenkách.

Dalším navrhovaným modelem speciace je speciace antirekombinací. V kvasinkách kontroluje rekombinační aparát identitu sekvence DNA mezi homologními chromozomy. Pokud je identita nízká, strojní zařízení potlačuje rekombinaci. V důsledku toho by hybrid mezi dvěma druhy kvasinek měl snížený počet rekombinačních událostí, což způsobuje nedisjunkci chromozomů v meióze a aneuploidii, což má za následek sníženou plodnost hybridu (Hunter et al. 1996 Greig et al. 2003 Liti et al. 2006). Všimněte si, že v tomto mechanismu zjevně hraje důležitou roli mutace, protože tento mechanismus závisí výhradně na divergenci genomové sekvence mezi dvěma populacemi, kde není nutný žádný přirozený výběr.


Část 1: Prozkoumejte

  1. Zadejte tuto nukleotidovou sekvenci DNA (vyhněte se mezerám!):
    ATGCTCTGTTTTATCTACGTCTCACCAACAGCCCATCAGAACAAGGATGAGTGGCGAAGCGGA
  2. Klikněte Přepsat a sledujte simulaci.
  3. Klikněte přeložit a sledujte simulaci.
  4. Prohlédněte si výsledný protein.
    • Kliknutím na aminokyseliny zjistíte jejich názvy.
    • Udělejte snímek bílkoviny.
  5. Popište proces v simulaci partnerovi. Co se stalo?

Pokud se mutace vyskytují náhodně v celé sekvenci genomu druhu, jak se může vyvíjet složitý orgán, jako je oko? Jak mohou být všechny mutace, které řídí vývoj toho orgánu, soustředěny na správná místa?

Při pohledu zpět do historie genomu druhu se zdá, že mutace jsou přitahovány určitými genomickými místy (a podobně odpuzovány ostatními). Zdání ale může klamat a výběr je skvělý iluzionista. Mutace, které se zpočátku vyskytují náhodně, mohou nakonec vypadat, že jsou „směrovány“ vysoce nerandomními vzory, protože většina mutací, které se vyskytnou, se z populace rychle ztratí, často jen v jedné generaci. Relativně málo mutací, které jsou ne ztraceni jsou ti, kteří přispívají k evoluční změně.

V populaci je každá jednotlivá mutace extrémně vzácná, když se poprvé vyskytuje často, existuje pouze jedna její kopie v genofondu celého druhu. Ale obrovské množství mutací se může vyskytnout každou generaci v tomto druhu jako celku. U více než šesti miliard jedinců je lidský druh nyní tak velký, že každý jeden pár bází ze tří miliard v genomu je několikrát mutován, někde v populaci, každou generaci. Některé z těchto mutací jsou tak škodlivé, že jsou odstraněny ještě předtím, než se jejich nositelé vůbec narodí. Ale velká většina mutací je neškodná (nebo alespoň tolerovatelná) a jen velmi málo z nich je skutečně užitečných. Ty vstupují do populace jako mimořádně vzácné alternativní verze genů, ve kterých se vyskytují.

Většina nových mutací bude ztracena jen proto, že jsou vzácné (i když jsou prospěšné), nicméně velmi malé účinky na přežití a reprodukci mohou výrazně ovlivnit dlouhodobou míru, s jakou se různé mutace hromadí v konkrétních genech a na konkrétních místech uvnitř geny. Výsledkem je vzorec evoluční změny, který vypadá nenuceně a ve skutečnosti opravdu je nonrandom: některé weby se téměř nikdy nemění, některé se mění příležitostně a jiné se mění relativně často.

To však neznamená, že samotné mutace se vyskytovaly náhodně. Zpětně to vypadá, jako by k nim došlo tam, kde je to potřeba. Ale ve skutečnosti se prostě hromadí tam, kde je to potřeba, a nejprve jedna, potom další a další, po mnoho generací. Získání dvou nebo více užitečných mutací ve stejném genomu může chvíli trvat, ale pokud nejsou ztraceny z populace, pak se to nakonec stane u sexuálního druhu.

Při pohledu zpět mohou biologové někdy usuzovat, že oko nebo nějaká jiná komplexní adaptace byla sestavena určitým způsobem (prostřednictvím určité posloupnosti evolučních změn). To přirozeně vede k myšlence, že tato adaptace musí být sestavena tímto konkrétním způsobem, přesně podle sekvence mutací. Mnoho důkazů a teorie ale ukazuje, že to téměř nikdy není pravda.

Hrubý a relativně neúčinný orgán snímající světlo může být mnohem lepší než vůbec žádný a mohou existovat tisíce různých mutací, které by různými způsoby mírně zlepšily jeho fungování. Když se jeden z nich objeví a má to štěstí, že se hned neztratí, a pak v rámci populace stoupá na frekvenci, připravuje půdu pro ostatní. Neexistuje však způsob, jak předpovědět, která mutace bude další, která uspěje.

Některé nedávné lidské adaptace se známou genetickou historií tento princip pěkně ilustrují. Například se v poslední době ukázalo, že rozšířená, ale ne univerzální schopnost trávit mléčný cukr laktózu v dospělosti (tolerance laktózy) vyplývá z některé z několika různých mutací v laktázovém genu a v jeho blízkosti. Ty se vyskytují v geograficky izolovaných populacích pocházejících z raných pastevců, kteří žili v různých částech Afriky a Eurasie. V tomto případě, stejně jako v jiných, se zdá, že v procesu došlo k velké náhodnosti, která určovala, která z mnoha možných mutací bude ta, která nakonec v daném čase a místě odpověděla na hovor.

Možná bylo předvídatelné, že dojde k adaptaci na nový zdroj potravy (mléko domestikovaných krav a koz), ale zjevně to nebylo předvídatelné, dokonce ani v zásadě, jak přesně k tomu dojde.


Adaptivní mutace

Další klíčovou otázkou je, zda k nějakým mutacím dochází, protože je organismus potřebuje. Existuje za tvorbou specifických mutací záměr nebo účel? Tato otázka byla vznesena po zjištění, že určité mutace se v bakteriích objevují pouze v případě potřeby.8 Problém je dále ilustrován studií, která zjistila vzácné, ale prospěšné mutace vyskytující se sekvenčně v rámci stejné bakterie.9 Někteří vědci se pokoušejí tyto mutace vysvětlit klasicky neodarwinistický rámec, 10 ale i jejich vlastní výpočty ukazují, že je vysoce nepravděpodobné, že by se tyto mutace vyskytly jen jako součást náhodného mutačního pozadí.11 Místo toho nelze žádný z těchto příkladů snadno vysvětlit náhodně se vyskytujícími mutacemi.

Tento jev se původně jmenoval cílené mutace, je nyní běžněji známý jako adaptivní mutace (pravděpodobně ke snížení implikace mutací vyskytujících se pro cílený účel). Je pochopitelné, že koncept byl velmi kontroverzní. Pokud nějaké mutace vzniknou kvůli potřebě organismu, místo aby se děly jen náhodně, naznačuje to režijní program-pravý opak klasického neodarwinismu.

Přesto přibývá důkazů, že mnoho mutací není při jejich tvorbě náhodné.12 Ve skutečnosti se zdá, že mnoho mutací a dalších genetických změn je specificky naprogramováno. K tomuto programování dochází v přesných fázích buněčné aktivity nebo v reakci na konkrétní podněty z prostředí.

Nedávné studie zjistily, že adaptivní reakce u bakterií mohou zahrnovat stejnou mutaci nezávisle vznikající v různých populacích.13 Také krátké templátové přepínače (inverze krátkých segmentů DNA) mohou generovat složité vzory mutací v lidských chromozomech.14 Kromě toho nyní víme že určité imunitní buňky používají vysoce generovanou mutační cestu ke generování jedinečných protilátek. 15 Buňky mohou změnit svůj stav chromozomů a vzorce methylace DNA v reakci na podněty prostředí.16 A alespoň jedna skupina enzymů se podílí na kontrole jak výskytu, tak umístění mutací u lidí.17


Odhalení tajemství o tom, jak dochází k chorobným mutacím DNA

Tým vědců z Penn State objasnil procesy, které vedou k určitým mutacím lidské DNA, které se podílejí na stovkách dědičných chorob, jako je tuberózní skleróza a neurofibromatóza typu 1. Výsledky jednoho dne by mohly ovlivnit způsob, jakým páry, které hledají děti získat genetické poradenství.

Tým vedený docentkou biologie Katerynou Makovou zahrnuje také Eriku Kvikstad, postgraduální studentku katedry biologie, a docentku statistiky Francescu Chiaromonte.

Vědci zkoumali inzerce a delece - mutace, ve kterých jsou malé fragmenty DNA buď přidány nebo odečteny z genomu - a našli vzory v sekvencích DNA bezprostředně obklopujících mutace. "Vzory v sekvencích DNA, které obklopují inzerce a delece, naznačují mechanismy, které mohly generovat inzerce a delece," řekl Chiaromonte. Podle vědců je studie první, která detekuje vzory v sekvencích DNA sousedících s inzercemi a delecemi fragmentů DNA v měřítku celého genomu.

Tým také zjistil výrazné rozdíly mezi vkládáním a odstraňováním. Například zjistili, že rozpoznávací místa pro enzym topoizomerázu, která je zodpovědná za navíjení a odvíjení DNA, převládají spíše blízko delecí než blízko inzercí. „Byli jsme překvapeni, když jsme zjistili, že vzorce sekvencí DNA obklopujících inzerce versus delece jsou jedinečné, protože vědci dříve spojili dva typy mutací dohromady,“ řekl Kvikstad.

Vědci také dříve věřili, že inzerce a delece jsou tvořeny většinou chybami, ke kterým dochází během replikace DNA, ale tým zjistil, že mutace mohou také vznikat mechanismy souvisejícími s rekombinací. „Zarážející je, že většina inzercí a delecí je způsobena chybami replikace, a přestože se jedná o primární zdroj generující mutace, zjistili jsme, že rekombinace je také velmi důležitá,“ řekl Kvikstad.

Pro jeden z prvních případů v celé genomové studii tým použil statistickou metodu, nazývanou waveletová analýza, která umožňuje vědcům sledovat variabilitu ve vzorku ve více měřítkách současně. Například soubory obrázků JPEG, které zachovávají různé vlastnosti obrázku bez ohledu na to, zda je obrázek zmenšen nebo zvětšen, používají podobnou metodu podobnou vlnovce. Podle Chiaromonte: „Když spustíte vlnovou analýzu, charakterizujete signály současně v mnoha měřítcích. V našem případě byl signál složením sekvencí DNA obklopujících inzerce a delece. Abyste se na tyto sekvence mohli podívat více -škálový přístup byl opravdu důležitý pro naši schopnost najít zajímavé funkce. “

Pomocí waveletové analýzy tým potvrdil, že měřítko je důležité pro detekci vzorců sekvencí DNA sousedících s inzercemi a delecemi. Byli například schopni detekovat zvýšený počet sekvencí DNA odpovědných za pozastavení DNA polymerázy, enzymu podílejícího se na replikaci DNA, v nejjemnějších měřítcích (10 až 20 párů bází DNA), nikoli však ve větších měřítcích.

Chyby replikace i rekombinace mohou u lidí vést k mutacím způsobujícím onemocnění. Podle vědců, pokud víme, že některé nemoci jsou pravděpodobněji způsobeny rekombinací než chybami při replikaci, mohou lékaři poskytnout lepší rady párům, které chtějí mít děti. "Například mezi muži a ženami je rozdíl v počtu replikačních kol, která jejich zárodečné buňky podstoupí. Samci podstoupí více kol replikace DNA než samice a počet replikačních kol se zvyšuje s věkem muže. Pokud víme, že nemoc je způsobena spíše chybou replikace než chybou rekombinace, lékaři mohou poskytnout párům lepší genetické poradenství, “řekla Maková.

Tato zjištění budou zveřejněna v čísle časopisu z července 2009 Výzkum genomu.

Tento výzkum získal podporu od National Institutes of Health a Penn State University.

Příběh Zdroj:

Materiály poskytnuté Penn State. Poznámka: Obsah lze upravit podle stylu a délky.