Informace

Jak se vyvíjela rozmanitost mezi fermentací ethanolem a fermentací kyselinou mléčnou?


Jednoduše řečeno, některé organismy metabolizují glukózu za anaerobních podmínek prostřednictvím Glukózy-> (2) Kyselina pyrohroznová-> (2) Etylalkohol. Některé organismy však metabolizují na kyselinu mléčnou.

Kdy takový proces (kyselina mléčná) vznikl biochemicky z jeho příbuzné (ethanolové) fermentace a jak byl vybrán? tj. jaké byly výhody?

Může také někdo vytvořit značku glykolýzy nebo fermentace?


Za prvé, z fyziologie nebo biochemických informací není jasné, jak určit, co se z čeho vyvinulo. Meziprodukt pyruvát je vždy tam, takže laktóza dehydrogenáza (LDH) a pyruvát dekarboxyláza (PDC) se každý mohl kdykoli vyvinout a pro oba existují dobré důvody:

  1. LDH: reakční pyruvát + NADH/H + = laktát + NAD + + 25 kJ/mol je vysoce exergonický, tj. Produkuje teplo
  2. PDC: reakční pyruvát = acetaldehyd + CO2 (a s přítomnou ALD) acetaldehyd + NADH/H + = ethanol + NAD +, kde je ethanol jedovatý pro jiné druhy

Přidejte k tomu, že existují organismy jako Sch. pombe které mají oba enzymy, takže můžete dělat obě reakce, vaše otázky by měly být spíše:

Jak se vyvinul enzym LDH?

Enzym je podobný malátdehydrogenáze, oba tvoří rodinu. Patří do skupiny enzymů, které všechny mají a Vazebná doména NAD (P), takže není příliš vzdálené tvrdit, že LDH a MDH se vyvinuly z jiného enzymu s vazebnou doménou NAD (P).

http://www.ebi.ac.uk/interpro/IEntry?ac=IPR016040

Jak se vyvinul enzym PDC?

Proteinové sekvence pyruvát dekarboxylázy (PDC) odvozené z genů klonovaných kvasinek (Saccharomyces cerevisiae) a bakterií (Zymomonas mobilis) byly porovnány navzájem a se sekvenčními databázemi. Byly nalezeny rozsáhlé podobnosti sekvencí mezi nimi a dvěma dalšími: pyruvát oxidázou spojenou s cytochromem z Escherichia coli a acetolaktát syntázou (ilvI v E. coli; gen ILV2 v S. cerevisiae). Všechny katalyzují dekarboxylaci pyruvátu za použití thiamin pyrofosfátu (TPP) jako kofaktoru. Obecná celková podobnost naznačuje společný původ těchto enzymů.

citováno z abstraktu

Zelený, Jeremy. „Pyruvát dekarboxyláza je jako acetolaktát syntáza ( ILV2) a ne jako podjednotka pyruvát dehydrogenázy E1.“ Dopisy FEBS 246.1 (1989): 1-5. http://www.ncbi.nlm.nih.gov/pubmed/2651151?dopt=Abstract


Řešení NCERT pro biologii třídy 11 Kapitola 14 Dýchání v rostlinách

Tato řešení jsou součástí řešení NCERT pro biologii třídy 11. Zde jsme uvedli řešení NCERT pro biologii třídy 11, kapitola 14 Dýchání v rostlinách.

Otázka 1.
Rozlišujte mezi nimi
(a) Dýchání a spalování
b) Glykolýza a Krebsův cyklus
c) Aerobní dýchání a kvašení
Řešení:
(A) Rozdíly mezi dýcháním a spalováním jsou následující:

b) Rozdíly mezi glykolýzou a Krebsovým cyklem jsou následující:

(C) Rozdíly mezi aerobním dýcháním a fermentací jsou následující:

Otázka 2.
Co jsou respirační substráty? Vyjmenujte nejběžnější respirační substrát.
Řešení:
Sloučeniny, které jsou během tohoto procesu oxidovány, jsou známé jako respirační substráty. Sacharidy se obvykle oxidují, aby se uvolnila energie, ale proteiny, tuky a dokonce i organické kyseliny lze za určitých podmínek použít jako respirační látku v některých rostlinách.

Otázka 3.
Schematicky znázorněte glykolýzu.
Řešení:

Otázka 4.
Jaké jsou hlavní kroky aerobního dýchání? Kde se to koná?
Řešení:
Při aerobním dýchání, které probíhá v mitochondriích, konečném produktu glykolýzy, je pyruvát transportován z cytoplazmy do mitochondrií.
Klíčové události v aerobním dýchání jsou:
Kompletní oxidace pyruvátu postupným odstraňováním všech atomů vodíku a ponecháním tří molekul CO2.
Předávání elektronů odstraněno jako součást atomů vodíku na molekulární O2 se současnou syntézou ATP.
První proces probíhá v matici mitochondrií, zatímco druhý proces se nachází na vnitřní membráně mitochondrií.
Pyruvát, který vzniká glykolytickým katabolismem uhlohydrátů v cytosolu, po vstupu do mitochondriální matrice prochází oxidační dekarboxylací komplexním souborem reakcí katalyzovaných pyruvicdehydrogenázou. Reakce katalyzované pyruvic dehydrogenázou vyžadují účast několika koenzymů, včetně NAD+ a koenzymu A.

Během tohoto procesu jsou dvě molekuly NADH vyrobeny z metabolismu dvou molekul kyseliny pyrohroznové (vyrobené z jedné molekuly glukózy během glykolýzy).
Acetyl CoA poté vstupuje do cyklické dráhy, cyklu trikarboxylových kyselin, běžněji nazývaného Krebsův cyklus.

Otázka 5.
Schematicky znázorněte celkový pohled na Krebsův cyklus.
Řešení:

Otázka 6.
Vysvětlete ETS.
Řešení:
ETS nebo elektronový transportní systém je umístěn ve vnitřní mitochondriální membráně. Pomáhá uvolňovat a využívat energii uloženou v NADH + H + a FADH2 NADH + H +, který se tvoří během cyklu glykolyzy a kyseliny citrónové, se oxiduje NADH dehydrogenázou. Takto generované elektrony se přenesou na ubichinon prostřednictvím FMN. Podobným způsobem, FADH2 generované během cyklu kyseliny citrónové se přenáší na ubichinon. Elektrony z ubichinonu jsou přijímány cytochromem bc1a dále se přenesou na cytochrom C. Cytochrom C funguje jako mobilní nosič mezi komplexem III a komplexem cytochrom C oxidázy obsahujícím cytochrom a a a3spolu s měděnými středy.


Během přenosu elektronů z každého komplexu je proces doprovázen produkcí ATP z ADP a anorganického fosfátu působením ATP syntázy. Množství produkovaného ATP závisí na molekule, která byla oxidována.

Otázka 7.
Rozlišujte následující:
a) Aerobní dýchání a anaerobní dýchání.
b) Glykolýza a fermentace.
c) Cyklus glykolýzy a kyseliny citrónové.
Řešení:
Rozdíly mezi aerobním a anaerobním dýcháním jsou následující:

Rozdíly mezi glykolýzou a fermentací jsou následující:

Rozdíly mezi cyklem glykolýzy a kyselinou citrónovou jsou následující:

Otázka 8.
Jaké jsou předpoklady učiněné při výpočtu čistého zisku ATP?
Řešení:

  • Funguje sekvenční, uspořádaná dráha, přičemž jeden substrát tvoří další a glykolýza, cyklus TCA a dráha ETS následují jeden po druhém.
  • NADH syntetizovaný v glykolýze je přenesen do mitochondrií a podléhá oxidační fosforylaci.
  • Žádný z meziproduktů v cestě není použit k syntéze jakékoli jiné sloučeniny.
  • Vdechuje se pouze glukóza -do cesty v žádném z přechodných stupňů nevstupují žádné jiné alternativní substráty.

Otázka 9.
Diskutujte „Dýchací cesta je amfibolická cesta“.
Řešení:
Dýchání je obecně považováno za katabolický proces, protože během dýchání se rozdělují různé substráty pro získávání energie. Sacharidy se před vstupem do dýchacích cest rozkládají na glukózu. Tuky se před vstupem do dýchání přeměňují na mastné kyseliny a glycerol, zatímco mastné kyseliny se přeměňují na acetyl CoA. Podobným způsobem se proteiny přeměňují na aminokyseliny, které po deaminaci vstupují do dýchání.

Během syntézy mastných kyselin se acetyl CoA stahuje z dýchací cesty. Při syntéze proteinů se také stahují respirační látky. Na anabolismu se tedy podílí také dýchání. Dýchání lze tedy nazvat jako. amfibolická cesta, protože zahrnuje jak anabolismus, tak katabolismus.

Otázka 10.
Definujte RQ. Jaká je jeho hodnota pro tuky?
Řešení:
Poměr objemu CO2 vyvinul do objemu O2 spotřebovaný při dýchání se nazývá respirační kvocient (RQ) nebo respirační poměr.

Otázka 11.
Co je oxidační fosforylace?
Řešení:

Přestože aerobní proces dýchání probíhá pouze za přítomnosti kyslíku, role kyslíku je omezena na konečnou fázi procesu. Přesto je přítomnost kyslíku životně důležitá, protože řídí celý proces odstraněním vodíku ze systému. Kyslík působí jako konečný akceptor vodíku. Na rozdíl od fotofosforylace, kde je to světelná energie, která se používá k produkci protonového gradientu potřebného pro fosforylaci, v dýchání je to energie oxidačně-redukční, která se používá pro stejný proces. Z tohoto důvodu se tento proces nazývá oxidační fosforylace.

Otázka 12.
Jaký je význam postupného uvolňování energie při dýchání?
Řešení:
Během oxidace v buňce se veškerá energie obsažená v respiračních substrátech neuvolňuje do buňky ani v jednom kroku. Uvolňuje se v sérii pomalých krokových reakcí řízených enzymy a je zachycován jako chemická energie ve formě ATP.

Proto je důležité pochopit, že energie uvolněná oxidací při dýchání se nepoužívá přímo, ale používá se k syntéze ATP, který se štěpí, kdykoli (a kdekoli) je třeba energii využít. ATP tedy funguje jako energetická měna buňky.

Tato energie zachycená v ATP se využívá v různých energeticky náročných procesech organismů a uhlíková kostra vzniklá během dýchání se používá jako prekurzory pro biosyntézu jiných molekul v buňce.

VELMI KRÁTKÉ ODPOVĚDI OTÁZKY

Otázka 1.
Co je anaerobní dýchání? (83. října)
Řešení:
Neúplný nebo částečný rozklad molekul paliva na sloučeniny, jako je ethylalkohol, kyselina mléčná v nepřítomnosti molekulárního kyslíku.

Otázka 2.
Pojmenujte konečného akceptora elektronu v ETC.
Řešení:
Kyslík je elektronický akceptor ETC.
Otázka 3.
Funkce kyslíku v aerobním dýchání:
(i) Funguje jako konečný akceptor elektronů.
(ii) Řídí celý proces odstraněním vodíku ze systému.
Řešení:
Funkce kyslíku v aerobním dýchání:
(i) Funguje jako konečný akceptor elektronů.
ii) Řídí celý proces odstraněním vodíku ze systému.

Otázka 4.
Co je dýchání? (86. října)
Řešení:
Oxidační proces, ve kterém je chemicky vázaná energie z komplexních molekul organického paliva, jako jsou uhlohydráty, bílkoviny a tuky, zachycována ve formě ATP.

Otázka 5.
Kde funguje elektronový transportní systém v mitochondriích?
Řešení:
Fosfhofruktokináza katalyzuje tvorbu fruktózy 1, 6 bisfosfátů z fruktózo-6-fosfátu.

Otázka 6.
Uveďte funkci fosfhofruktokinázy při glykolýze.
Řešení:
Hexokináza-pomáhá při fosforylaci glukózy.

Otázka 7.
Pojmenujte enzym, který katalyzuje fosforylaci glukózy.
Řešení:
Tvorba acetyl CoA probíhá v mitochondriální matrici.

Otázka 8.
Kde v buňce probíhá tvorba acetyl CoA?
Řešení:
Prvním krokem v Krebsově cyklu je kondenzace acetylové skupiny (acetyl CoA) s kyselinou oxalooctovou (OAA) za vzniku kyseliny citrónové a uvolnění koenzymu A.

Otázka 9.
Jaký je první krok reakce v cyklu TCA?
Řešení:
Mastné kyseliny mohou být převedeny na acetyl CoA dříve, než se dostanou z respiračních substrátů.

Otázka 10.
Co je alkoholové kvašení?
Řešení:
Alkoholická fermentace je proces, při kterém kvasinkové buňky štěpí za anaerobních podmínek glukózu na ethylalkohol a oxid uhličitý.

Otázka 11.
Pojmenujte oxidační cestu, kterou se nakonec oxidují intermediární metabolity glukózy, mastných kyselin a aminokyselin.
Řešení:
36 molekul ATP/38 ATP se získává v procesu dýchání a souvisí s typem aerobního dýchání.

Otázka 12.
Co je fermentace kyseliny mléčné? (Říjen 2001)
Řešení:
Je to proces kvašení, při kterém se laktóza nacházející se v mléce přeměňuje na kyselinu mléčnou působením laktobacilu.

Otázka 13.
Jaké jsou dvě molekuly získané působením aldolázy z fruktózy -1, -6 -bifosfátu?
Řešení:
Vyrábí se ATP.

KRÁTKÉ ODPOVĚDI OTÁZKY

Otázka 1.
Jak je stanoven protonový gradient?
Řešení:
Protonový gradient se stanoví průchodem protonu (H +) z matice přes vnitřní mitochondriální membránu do mezimembránového prostoru s energií uvolněnou při přenosech elektronů v ETC.

Otázka 2.
Popište kroky při tvorbě kyseliny mléčné z kyseliny pyrohroznové.
Řešení:
Kyselina pyrohroznová je katalyzována enzymem mléčnou dehydrogenázou. NADH vytvořený při glykolýze se používá k redukci.

Otázka 3.
Jak je ATP tvořen energií uvolněnou během systému přenosu elektronů v mitochondriích?
Řešení:
Formace ATP vyžadují enzym zvaný ATP syntáza. Má dvě složky F0– F1. ATP-syntáza se aktivuje při tvorbě ATP, když koncentrace H + na FÓ strana je vyšší než F1 boční. Koncentrace protonů ve vnější komoře způsobuje, že proton prochází vnitřní komorou. F1 částice indukovaná tokem protonu FÓ kanál. Energie protonového gradientu váže fosfátový radikál na ADP. To produkuje ATP.

Otázka 4.
Podejte podrobný popis čistého zisku ATP v různých fázích dýchání.
Řešení:

Ve většině eukaryotických buněk jsou k transportu NADH produkovaného glykolýzou do mitochondrií pro další oxidaci zapotřebí 2 molekuly ATP. Čistý zisk ATP je tedy 36 molekul.

Otázka 5.
Vyjmenujte funkce ATP.
Řešení:
Funkce ATP:-
(i) ATP funguje jako univerzální nosič energie živých systémů.
ii) ATP ukládá do svých molekul malé balíčky energie.
iii) V cele je mobilní. Proto se dostane do všech částí buňky mimo oblast syntézy ATP.
(iv) Aktivuje řadu chemikálií tím, že funguje jako fosforylační činidlo.
(proti) ATP poskytuje energii pro svalové kontrakce.
(vi) Podílí se na transportu látek proti koncentračnímu gradientu.

Otázka 6.
Kde se nachází cytochrom c? Jaká je jeho funkce?
Řešení:
Cytochrom c se nachází na vnějším povrchu vnitřní mitochondriální membrány. Funguje jako mobilní nosič pro přenos elektronů mezi komplexem III a komplexem IV elektronového transportního systému.

Otázka 7.
Definujte respirační kvocient.
Řešení:
Dýchací kvocient je definován jako poměr objemu uvolněného oxidu uhličitého k objemu kyslíku spotřebovaného při dýchání.

Otázka 8.
Co je oxidační fosforylace?
Řešení:
Celý proces, kterým kyslík účinně umožňuje produkci ATP fosforylací ADP, se nazývá oxidační fosforylace.

Otázka 9.
Energetický výnos, pokud jde o ATP, je při aerobním dýchání vyšší než při anaerobním dýchání. Proč existuje anaerobní dýchání i v organismech, které žijí v aerobních podmínkách, jako jsou lidské bytosti a krytosemenné rostliny?
Řešení:
Aerobní organismy se potýkají se situacemi, kdy je dostupnost kyslíku malá. Například přepracované svaly nedostávají při namáhavém cvičení dostatek kyslíku. Podobně hluboko uložené tkáně krytosemenných rostlin nedostávají dostatek kyslíku difúzí zvenčí. V takových situacích může k přežití tkáně pomoci pouze anaerobní dýchání.

Otázka 10.
Komentář k tvrzení- „Dýchání je proces produkující energii, ale v některých fázích procesu se používá ATP“.
Řešení:
ATP je vyžadován ve všech reakcích, kde je vyžadována fosforylativní aktivace substrátu. Navzdory produkci energie (jako ATP) proto dýchání v určitých krocích vyžaduje ATP, např. Glukóza – glukóza 6-fosfát, fruktóza 6-fosfát-fruktóza 1, 6-bisfosfát.

OTÁZKY S DLOUHOU ODPOVĚĎ

Otázka 1.
Vysvětlete hlavní kroky Krebsova cyklu. Proč se tomuto cyklu také říká cyklus kyseliny citrónové?
Řešení:
Krebsův cyklus: Tento proces probíhá v mitochondriální matici.
Hlavní kroky Krebsova cyklu jsou následující:

  • Acetyl Co-A, vytvořený oxidační dekarboxylací kyseliny pyrohroznové, vstupuje do Krebsova cyklu.
  • Kombinuje se s kyselinou oxalooctovou (OAA), 4C-sloučeninou, za vzniku 6C-sloučeniny, kyselina citrónová reakce je katalyzována citrát syntázou.
  • Citrát se poté izomeruje na isocitrát.
  • Isocitrát se převádí na kyselinu oxalosukcinovou v přítomnosti NAD a isocitrátdehydrogenázy.
  • Kyselina oxalosukcinová se poté dekarboxyluje na kyselinu a-ketoglutarovou (KG) v přítomnosti enzymu dekarboxylázy.
  • Kyselina a-ketoglutarová se převádí na sukcinyl Co-A v přítomnosti NAD, Co-A a enzymu a-ketoglutarát dehydrogenázy.
  • Když je sukcinyl Co-A přeměněn na kyselinu jantarovou, vytvoří se jedna molekula GTP a uvolní se Co-A.
  • Ve zbývající části cyklu je kyselina jantarová přeměněna na OAA, takže cyklus kyseliny citronové může pokračovat v provozu.
  • Během tohoto cyklu jsou tři molekuly NAD a jedna molekula FAD redukovány na NADH a FADH.
  • Tento cyklus se nazývá cyklus kyseliny citrónové, protože prvním produktem je kyselina citrónová, což je 3-C sloučenina.

Otázka 2.
Pojmenujte konečný produkt glykolýzy. Kde se v buňce vyrábí? Diskutujte o oxidativní dekarboxylaci.
Řešení:
Výsledkem glykolýzy jsou dvě molekuly kyseliny pyrohroznové, NADH a ATP. Vyskytuje se v cytosolu buňky.
Aerobní oxidace: Jeden ze tří uhlíků kyseliny pyrohroznové se oxiduje na oxid uhličitý v reakci zvané oxidační dekarboxylace. Kyselina pyrohroznová je nejprve dekarboxylována a poté oxidována enzymem pyruvová dehydrogenáza. Tyto dvě uhlíkové jednotky jsou koenzymem-A (Co-A) snadno přijímány za vzniku acetyl Co-A. Souhrn reakce je uveden v následující rovnici:

Kyselina pyruvová tedy vstupuje do Krebsova cyklu jako acetyl Co-A. Krebsův cyklus probíhá v mitochondriální matici.
Acetyl Co-A, vytvořený oxidační dekarboxylací kyseliny pyrohroznové, vstupuje do Krebsova cyklu.

Otázka 3.
Schematicky znázorňují vzájemný vztah mezi metabolickými cestami v rostlině a ukazují rozpad různých organických sloučenin zprostředkovaný dýcháním.
Řešení:
Schematické znázornění mezi metabolickými cestami ukazující dýchání zprostředkované rozpadem různých organických molekul na CO2 a H.2Ó:

Otázka 4.
Jak rostliny řídí výměnu plynů? Dejte přehled o dýchání v rostlinách.
Řešení:
Rostliny, na rozdíl od zvířat, nemají specializované orgány pro výměnu plynů, ale mají k tomuto účelu průduchy a lenticely. Existuje několik důvodů, proč se rostliny mohou obejít bez dýchacích orgánů.

  • Každá část závodu se stará o své vlastní potřeby výměny plynu. Přeprava plynů z jedné části rostliny do druhé je velmi malá.
  • Rostliny nepředstavují velké nároky na výměnu plynu. Kořeny se zastavují a opouštějí dýchání nižší rychlostí než zvířata.
  • Pouze během fotosyntézy se vyměňují velké objemy leasingu a každý list je dobře přizpůsoben tak, aby se v těchto obdobích staral o své vlastní potřeby.
  • Když buňky provádějí fotosyntézu, dostupnost O2 není v těchto buňkách problém od 02 je vydána
  • Vzdálenost, kterou musí plyny difundovat i ve velkých objemných rostlinách, není velká. Každá živá buňka v rostlině se nachází docela blízko povrchu rostliny.
  • I v dřevnatých stoncích jsou „živé“ buňky uspořádány v tenkých vrstvách uvnitř a pod kůrou. Mají také otvory zvané lenticely. Buňky v interiéru jsou mrtvé a poskytují pouze mechanickou podporu.
  • Většina buněk rostliny tedy prokázala část svého povrchu ve styku se vzduchem. To je také usnadněno volným zabalením buněk parenchymu do listů, stonků a kořenů, které poskytují propojenou síť vzdušných prostorů.
  • Úplné spalování glukózy, které produkuje C02 a H.20 jako konečné produkty, přináší energii. Většina energie je vydávána jako teplo.
    C6H12Ó6 + 6O2 → 6C02 + 6H20 + energie
  • Pokud má být tato energie pro buňku užitečná, měla by být schopná ji využít k syntéze dalších molekul, které buňka vyžaduje.
  • Strategie, kterou používá rostlinná buňka, je katabolizovat molekulu glukózy takovým způsobem, aby ne všechna uvolněná energie zhasla jako teplo.
  • Klíčem je oxidovat glukózu ne v jednom kroku, ale v několika malých krocích, což umožňuje, aby některé kroky byly dostatečně velké, aby uvolněná energie mohla být spojena se syntézou ATP.

Doufáme, že vám řešení NCERT pro třídu 11 Biologie v práci Kapitola 14 Respirace v rostlinách pomůže. Pokud máte jakýkoli dotaz týkající se řešení NCERT pro třídu 11 Biologie při práci Kapitola 14 Dýchání v rostlinách, napište komentář níže a my se vám ozveme nejdříve.


Jak se vyvíjela rozmanitost mezi fermentací ethanolem a fermentací kyselinou mléčnou? - Biologie

Rozmanitost metabolismu v prokaryotech (strana 1)

O mikrobiální rozmanitosti se dělá spousta hoopla. Jednobuněčné eukaryoty (protista) vykazují značné množství strukturální rozmanitosti, ale prokaryotům (bakteriím a archea) toto rozlišení chybí. Existuje jen několik základních morfologií, možnosti motility a klidových buněk (spory) a hlavní diferenciální barvení (Gramovo barvení), které rozlišuje prokaryota mikroskopicky. O čem je tedy ta hoopla ohledně prokaryot? Jde o biochemické resp metabolická rozmanitost, zejména pokud jde o energetický metabolismus a biosyntézu sekundárních metabolitů. Prokaryoty jako skupina provádějí všechny stejné typy základního metabolismu jako eukaryoty, ale kromě toho existuje několik typů metabolismu generujícího energii mezi prokaryoty, které v eukaryotických buňkách nebo organizmech neexistují. Rozmanitost prokaryotů je vyjádřena jejich velkou variabilitou v režimech výroby energie a metabolismu a tato funkce umožňuje prokaryotům vzkvétat na všech stanovištích vhodných pro život na Zemi.

I v rámci prokaryotického druhu může existovat velká všestrannost metabolismu. Zvážit Escherichia coli. Bakterie může produkovat energii pro růst fermentací nebo dýcháním. Může dýchat aerobně pomocí O2 jako konečný akceptor elektronů, nebo může dýchat za anaerobních podmínek pomocí NO3 nebo fumarovat jako terminální elektronový akceptor. E-coli může použít glukózu nebo laktózu jako jediný zdroj uhlíku pro růst s metabolickou schopností přeměnit cukr na všechny potřebné aminokyseliny, vitamíny a nukleotidy, které tvoří buňky. Příbuzný z E-coli, Rhodospirillum rubrum, má všechny heterotrofní schopnosti jako E-coli, plus schopnost růst fotoautotrofními, fotoheterotrofními nebo litotrofními prostředky. Vyžaduje to jeden růstový faktor, nicméně do jeho růstového média musí být přidán biotin.

V zásadě většina eukaryotů produkuje energii (ATP) fermentací alkoholem (např. Kvasinkami), fermentací kyseliny mléčné (např. Svalové buňky, neutrofily), aerobním dýcháním (např. Plísně, prvoci, zvířata) nebo kyslíkovou fotosyntézou (např. Řasy, rostliny). Tyto způsoby metabolismu generujícího energii existují mezi prokaryoty, kromě všech následujících typů výroby energie, které v eukaryotech prakticky neexistují.

Unikátní fermentace postupující cestou Embden-Meyerhof

Jiné cesty kvašení jako jsou dráhy fosfoketolázy (heterolaktické) a Entner-Doudoroff

Anaerobní dýchání: dýchání, které používá jiné látky než O2 jako konečný akceptor elektronů

Litotrofie: využití anorganických látek jako zdrojů energie

Fotoheterotropie: použití organických sloučenin jako zdroje uhlíku při bakteriální fotosyntéze

Anoxygenní fotosyntéza: fotofosforylace v nepřítomnosti O2

Methanogeneze: starověký typ archaeanského metabolismu, který využívá H2 jako zdroj energie a produkuje metan

Světlem řízená nefotosyntetická fotofosforylace: jedinečný archaeanský metabolismus, který přeměňuje světelnou energii na energii chemickou

Mezi autotrofními prokaryoty navíc existují tři způsoby, jak opravit CO2, z nichž dva jsou mezi eukaryoty neznámé, CODH (dráha acetyl CoA) a reverzní cyklus TCA.

Metabolismus generující energii Termín metabolismus označuje součet biochemických reakcí potřebných pro generování energie A využití energie k syntéze buněčného materiálu z malých molekul v prostředí. Metabolismus má tedy složka generující energii, volala katabolismus, a energeticky náročné, biosyntetická složka, volala anabolismus. Katabolické reakce nebo sekvence produkují energii jako ATP, který může být použit v anabolických reakcích ke stavbě buněčného materiálu ze živin v prostředí. Vztah mezi katabolismem a anabolismem je znázorněn na obrázku 1 níže.
Obrázek 1. Vztah mezi katabolismem a anabolismem v buňce. Během katabolismu se energie mění z jedné formy do druhé a v souladu se zákony termodynamiky nejsou takové energetické transformace nikdy zcela účinné, tj. Část energie se ztrácí ve formě tepla. Účinnost katabolické sekvence reakcí je množství energie dostupné buňce (pro anabolismus) děleno celkovým množstvím energie uvolněné během reakcí.

Během katabolismu je užitečná energie dočasně konzervována ve „vysokém energetickém svazku“ ATP - adenosintrifosfát. Bez ohledu na to, jakou formu energie buňka používá jako svůj primární zdroj, energie je nakonec transformována a konzervována jako ATP - univerzální měna energetické výměny v biologických systémech. Pokud je během anabolismu potřeba energie, lze ji použít jako vysokoenergetickou vazbu ATP, která má hodnotu asi 8 kcal na mol. Konverze ADP na ATP tedy vyžaduje 8 kcal energie a hydrolýza ATP na ADP uvolní 8 kcal.


Obrázek 2. Struktura ATP. ATP je odvozen od nukleotidového adenosinmonofosfátu (AMP) nebo kyseliny adenylové, ke kterému jsou pomocí pyrofosfátových vazeb připojeny dvě další fosfátové skupiny (

P). Tyto dvě vazby jsou energeticky bohaté v tom smyslu, že jejich hydrolýza poskytuje mnohem více energie než odpovídající kovalentní vazba. ATP působí jako koenzym v energetických vazebných reakcích, ve kterých je jedna nebo obě koncové fosfátové skupiny odstraněny z molekuly ATP s energií vazby, která je použita k přenosu části ATP do jiné molekuly k aktivaci její role v metabolismu. Například Glukóza + ATP ----- & gt Glukóza-P + ADP nebo aminokyselina + ATP ----- & gtAMP-aminokyselina + PPi.

Vzhledem k ústřední roli ATP v energetickém metabolismu očekávejte jeho zapojení jako koenzymu ve většině energetických procesů v buňkách.


Stáhnout teď!

Usnadnili jsme vám nalezení e -knih ve formátu PDF bez jakéhokoli kopání. A tím, že máte přístup k našim elektronickým knihám online nebo je uložíte ve svém počítači, získáte praktické odpovědi s průvodcem biologické studie Fermentace a buněčné dýchání. Chcete -li začít s hledáním biologického studijního průvodce fermentací a buněčným dýcháním, jste na správné stránce, kde je uvedena komplexní sbírka příruček.
Naše knihovna je největší z nich, kde jsou zastoupeny doslova stovky tisíc různých produktů.

Konečně dostávám tuto e -knihu, díky za všechny tyto biologické studijní příručky Fermentace a buněčné dýchání, které nyní mohu získat!

Nemyslel jsem si, že by to fungovalo, můj nejlepší přítel mi ukázal tento web a funguje to! Mám nejžádanější e -knihu

wtf tento skvělý ebook zdarma ?!

Moji přátelé jsou tak šílení, že nevědí, jak mám všechny vysoce kvalitní ebooky, které nemají!

Je velmi snadné získat kvalitní e -knihy)

tolik falešných stránek. toto je první, který fungoval! Mnohokrát děkuji

wtffff tomu nerozumím!

Stačí kliknout a poté stáhnout a dokončit nabídku ke stažení e -knihy. Pokud existuje průzkum, který trvá pouze 5 minut, vyzkoušejte jakýkoli průzkum, který vám vyhovuje.


2. MATERIÁLY A METODY

2.1 Organismus a podmínky fermentace

LAB použité v této studii byly L. lactis subsp. cremoris MG1363, L. lactis subsp. lactis IL1403, S. thermophilus LMG 18311 a L. mesenteroides subsp. cremoris ATCC 19254. Chemicky definované médium (CDM) popsané (Otto et al., 1983) a modifikované (Poolman & Konings, 1988) bylo použito pro přípravu inokula a pro fermentace (úplný seznam složek viz Podpora Information File-1, Table S1), a CDM byl sterilizován filtrem s 0,22 µm filtry. Fermentační experimenty byly prováděny za anaerobních podmínek v 1litrovém míchaném tankovém bioreaktoru (Biostat Q, B. Braun Biotech International) s pracovním objemem 0,6 1 při konstantní teplotě a bez kontroly pH (počáteční pH 6,8). Dvoudruhová společná kultura L. lactis subsp. cremoris a Leu. mesenteroidy, a třídruhová společná kultura L. lactis subsp. cremoris, L. lactis subsp. lactis a Leu. mesenteroidy se předpokládalo, že představují mezofilní startovací kultury sýra, zatímco dvoudruhová kokultura L. lactis subsp. cremoris a S. thermophilus, a třídruhová společná kultura L. lactis subsp. cremoris, L. lactis subsp. lactis a S. thermophilus Předpokládalo se, že představují termofilní startovací kultury sýra. Čisté kultury L. lactis, Leu. mesenteroidy, a S. thermophilus kmeny byly fermentovány při 30 ° C, 30 ° C, respektive 37 ° C, zatímco mezofilní a termofilní kokultury byly pěstovány při 30 ° C, respektive 33 ° C. Fermentační médium bylo propláchnuto filtrem sterilizovaným N2 dokud rozpuštěný kyslík neklesl na nulu před očkováním a po naočkování nedošlo k přívodu plynu. Údržba anaerobních podmínek byla předpokládána pomalým mícháním (50 ot / min). U čistých i společných kultur byl bioreaktor naočkován 2% (obj./obj.) Inokulační kulturou pěstovanou do pozdní exponenciální fáze. Počáteční složení biomasy kokultur na základě měření optické hustoty (OD) bylo 1: 1 (OD: OD) a 1: 1: 1 (OD: OD: OD) pro dvoukulturní a třídruhové kokultury . Pro každý jiný dávkový experiment (čisté a společné kultury) byly spuštěny dvě nezávislé replikáty kultury.

2.2 Analytické techniky

Koncentrace biomasy byla stanovena pomocí OD měření fermentační kultury při 600 nm, která byla poté korelována se suchou hmotností biomasy (gDW). Vzorky kultury byly centrifugovány při 10 000G po dobu 10 minut a supernatant bez buněk byl použit pro analýzu glukózy, organických kyselin a aminokyselin. Biomasové vzorky kokultur byly okamžitě skladovány při -20 ° C, dokud nebyla provedena analýza relativní mikrobiální hojnosti. Koncentrace glukózy byla stanovena redukční analýzou cukru pomocí metody DNS (Miller, 1959). Koncentrace organických kyselin a aminokyselin byly stanoveny vysoce výkonnou kapalinovou chromatografií, jak bylo popsáno dříve (Özcan et al., 2019). CO2 výrobní profily L. lactis a S. thermophilus kmeny vykazující homolaktické fermentační vzorce byly považovány za zanedbatelně malé ve srovnání s celkovým odtokem uhlíku za anaerobních podmínek, jak je také uvedeno v literatuře (Jensen et al., 2001). Molární koncentrace ethanolu a CO2 produkovaný Leu. mesenteroidy byly odhadnuty na základě spotřeby glukózy a citrátu, jak je popsáno v naší předchozí studii (Özcan et al., 2019).

2.3 Odhad relativní mikrobiální četnosti v kokulturách

Pro kvantifikaci relativních poměrů mikrobiální četnosti různých bakteriálních kmenů během kokultivace byla použita metoda kvantitativní PCR (qPCR). Celkové koncentrace sušiny buněčných kultur společných kultur byly vynásobeny relativními poměry mikrobiální hojnosti k odhadnutí jednotlivých koncentrací biomasy. Extrakce DNA byla provedena pomocí soupravy peqGOLD Bacterial DNA Kit (Peqlab, VWR), podle protokolu výrobce, ze 3 ml kultury. Primery použité pro postup qPCR (tabulka 1) jsou specifické pro cílové genomy a iTaq Universal SYBR Green Supermix (Bio-Rad). Pro všechny vzorky byl použit následující protokol PCR: počáteční denaturace při 95 ° C po dobu 5 minut, 40 cyklů při 95 ° C po dobu 15 s, 62 ° C po dobu 30 s a analýza křivky tání s přírůstky 0,5 ° C/5 s od 65 ° C až 95 ° C pomocí CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Přední sekvence primerů Reverzní sekvence primerů Velikost produktu PCR Reference
L. lactis subsp. cremoris MG1363 GTGCTTGCACCAATTTGAA GGGATCATCTTTGAGTGAT 163 Pu a kol. (2002)
L. lactis subsp. lactis IL1403 GTACTTGTACCGACTGGAT GGGATCATCTTTGAGTGAT 163 Pu a kol. (2002)
S. thermophilus LMG 18311 CGGGTGAGTAACGCGTAGGT CGCCTAGGTGAGCCATTACC 177 Tato studie
Leu. mesenteroidy ATCC 19254 CCGCATCTTCACGGGTATTT AGTTTCGGCGAAGGTACGAA 173 Tato studie

2.4 Metabolické modely v genomovém měřítku (GSMM) použité v této studii

Metabolický model v genomovém měřítku (GSMM) Leu. mesenteroidy ATCC 19254 (Özcan et al., 2019), L. lactis subsp. cremoris MG1363 (Flahaut et al., 2013) a revidovaná verze S. thermophilus V této studii byly použity LMG 18311 (Pastink et al., 2009), což byly stejné kmeny jako v experimentech. GSMM z L. lactis subsp. cremoris K simulaci experimentálních dat obou byl použit MG1363 (Flahaut et al., 2013) L. lactis subsp. cremoris a L. lactis subsp. lactis. Kromě použití parametrů specifických pro kmen, auxotrofie aminokyselin L. lactis subsp. lactis byl také zvažován pro simulaci tohoto kmene. Výměnné reakce argininu, glutaminu, histidinu, isoleucinu, leucinu, methioninu a valinu byly omezeny takovým způsobem, že model může tyto aminokyseliny konzumovat pouze pro simulaci L. lactis subsp. lactis, protože L. lactis subsp. lactis Je známo, že IL1403 není schopen syntetizovat tyto aminokyseliny (Aller et al., 2014 Cocaign-Bousquet et al., 1995 van Niel & Hahn-Hägerdal, 1999). GSMM z S. thermophilus LMG 18311 (Pastink et al., 2009) byl revidován pomocí následujících kroků: i) návrh GSMM S. thermophilus LMG 18311 byl rekonstruován pomocí genomové sekvence S. thermsophilus LMG 18311 (Bolotin et al., 2004 GenBank přístupové číslo GCA_000011825.1) od MetaDraft (BG Olivier 2018. [Online], https://systemsbioinformatics.github.io/metadraft) (ii) nová reakční sada byla porovnána s tou původního modelu a reakce, které jsou k dispozici pouze v novém návrhu modelu, byly přidány do původního modelu, aby se získal revidovaný GSMM S. thermophilus LMG 18311. Revidovaný GSMM z S. thermophilus LMG 18311 obsahující 829 reakcí mezi 886 metabolity řízenými 429 geny je k dispozici ve formátu SBML v souboru podpůrných informací-3. Poměry udržování ATP související s nerůstem používané v GSMM byly získány z původních modelových studií (Flahaut et al., 2013 Oliveira et al., 2005 Özcan et al., 2019 Pastink et al., 2009). Pro simulaci kultur ke konci šarže nemusí nízká rychlost příjmu glukózy podporovat původní udržovací rychlost ATP (mATP) omezení, což má za následek nerealizovatelné řešení. V takových případech jsme kvůli účelům modelování postupně snižovali mATP hodnotu o 0,1 mmol/gDW/h, dokud nebyl získán proveditelný roztok. Takové snížení v mATP byl také nedávno prokázán ve studii, kde L. lactis a Leu. mesenteroidy byly pěstovány v retentostatickém reaktoru jako společná kultura a mATP hodnoty obou druhů klesaly při nízkých rychlostech růstu ve srovnání s vysokými rychlostmi růstu (van Mastrigt et al., 2019).

2.5 Dynamické metabolické modelování čistých a kokultur

Koncentrační profily biomasy a extracelulárních metabolitů dávkových kultur byly simulovány přístupy dynamického metabolického modelování. Pro čistou kulturu L. lactis subsp. cremoris, L. lactis subsp. lactis, S. thermophilus a Leu. mesenteroidy, zatímco pro kokultury byl použit přístup dynamického kokultivačního metabolického modelování (Hanemaaijer et al., 2017 Zhuang et al., 2011, 2012), což je přístup dFBA přizpůsobený pro vícedruhové systémy (obrázek 1). V dynamických modelech byly zapsány diferenciální hmotnostní bilance pro následující extracelulární metabolity: experimentálně měřené metabolity (glukóza, organické kyseliny a aminokyseliny), další metabolity ve fermentačním médiu (vitamíny a nukleové kyseliny) a metabolity, o nichž je známo, že se produkují (aromatické sloučeniny).

(1) (2) (3) (4)

Distribuce metabolického toku v dynamických modelech byla vypočítána dvěma sekvenčními optimalizacemi. Prvním z nich je problém lineárního programování (LP) (tj. Analýza bilance toku, FBA Orth et al., 2010), který maximalizuje rychlost růstu omezením modelů s mírou využití uhlíku a mírou využití aminokyselin, a sekundární optimalizace je problém kvadratického programování (QP), který minimalizuje celkový součet absolutních toků.QP aplikovaná v analýzách toku jako sekundární optimalizace po LP je založena na principu minimálního využití zdrojů enzymů k dosažení primárního cíle a také pomáhá vyhnout se alternativnímu problému optima (Lewis et al., 2010 Tarlak et al. (2014). Analýzy metabolického toku byly provedeny pomocí nástroje COBRA Toolbox (Schellenberger et al., 2011) v prostředí MATLAB, přičemž optimalizačním řešením byl Gurobi6 (http://www.gurobi.com). Soubory obyčejné diferenciální rovnice (ODE) v dynamických modelech byly řešeny pomocí ode45, což je funkce MATLAB založená na numerické metodě Runge-Kutta. Nakonec byly jako počáteční podmínky pro roztok sad ODE použity experimentálně získané počáteční koncentrace biomasy a metabolitů.

Parametry kinetiky absorpce substrátu v rovnici (1) byly dynamicky odhadnuty optimalizačním nástrojem MEIGO (Egea et al., 2014). Kmenově specifické kinetické parametry byly odhadnuty pomocí experimentů s čistou kulturou a byly použity jak v čistých, tak v kokultivačních modelech.


Historie a biochemie fermentovaných potravin

Zatímco proces kvašení výrazně předchází vzniku našeho druhu, lidé využívají tuto mikrobiální technologii pro produkci a uchovávání potravin po tisíce let. V mnoha případech mohou specifická fermentovaná jídla působit jako ukazatel kulturní identity a možná nás vtáhnout zpět do chutí a vůní babiččiny kuchyně. Zde se ponoříme do historie a vědy o fermentovaných potravinách.

Část staroegyptského artefaktu zobrazujícího pěstování hroznů a vinařství. Zdroj: Ägyptischer Maler um 1500 v. Chr. [Veřejná doména] prostřednictvím Wikimedia Commons

Stručná historie

V kulinářském smyslu je fermentace přeměna a uchování potravin bakteriemi. Přestože proces kvašení jako kulinářská praxe sahá až do rané lidské civilizace, trvalo velmi dlouho, než byly vědecké principy pochopeny (1). Archeologické studie však ukázaly, že fermentační technologie byly dobře zavedenými součástmi starověkých civilizací, a dokonce existují důkazy, že koncept „startovacích“ kultur byl široce oceňován a udržován (2-5). Níže uvedená tabulka zdůrazňuje několik milníků fermentace v kontextu kulinářské antropologie:

Vybrané milníky fermentace v historii lidstva. Tabulka převzata z „Historie fermentovaných potravin“. (2)

Úsvit biochemie

Ne příliš mladý Louis Pasteur

I přes neuvěřitelnou a bohatou antropologickou historii používání fermentace pro konzervaci potravin jsme se až v novějších dobách začali učit, že fermentace je metabolický proces, který je vlastní mikroorganismům. Když byla semena mikrobiologie zaseta objevením bakterií Antoniem Van Leeuwenhoekem (1683), začal se formovat moderní vědecký podnik a v centru tohoto hnutí byla fermentace. Nejprve se předpokládalo, že rozpad a smrt mikroorganismů vedly k fermentovaným potravinám, jak teoretizoval německý chemik Justus Von Liebig (6). V roce 1857 však mladý francouzský vědec jménem Louis Pasteur učinil zajímavé pozorování, které zpochybnilo tento pojem —, a to vše kvůli problému s průmyslovou výrobou alkoholického nápoje (7).

Šťáva pro řepu je historicky kvašený nápoj

Rok před zveřejněním těchto důležitých postřehů Pasteur ho oslovil průmyslník z Lille, pan Bigo, který vyráběl alkohol z řepné šťávy. Mnoho kádí Bigoovy řepné šťávy nebylo přeměněno na alkohol a místo toho šťáva kysela (spíše jako ocet). Tento jev ohrožoval jeho podnikání, a tak Pasteur přišel vyšetřovat.

Pasteur částečně použil mikroskopii k pochopení chemického a biologického základu fermentovaných potravin

Pasteur pomocí mikroskopu prohlédl vzorky z úspěšných kádí (obsahujících alkohol) a všiml si přítomnosti pěkných, tučných kuliček. Při pohledu na zakysané vzorky však viděl jen tenké podlouhlé částice. Další studií také dospěl k závěru, že zakysaný vzorek obsahuje kyselinu octovou, což rozhodně není alkohol!

Aby tento rozdíl pochopil, pokračoval v charakterizaci vyráběného alkoholu jako „úspěšně“ kvašené řepné šťávy a Pasteur zjistil, že tato sloučenina je opticky aktivní. Již několik let studoval stereochemii a jeho předchozí pozorování naznačovala, že všechny organické sloučeniny s optickou aktivitou byly tvořeny živými organismy (8). Došel tedy k závěru, že za metabolický proces fermentace jsou zodpovědné živé buňky:

Chemické změny fermentace jsou spojeny s životně důležitou činností, počínaje a konče touto. Domnívám se, že alkoholové kvašení nikdy neprobíhá bez současné organizace, vývoje a rozmnožování buněk nebo pokračování života již vytvořených buněk. Všechny výsledky v tomto článku mi připadají zcela v rozporu s názory Liebiga a Berzelius …Nyní … v čem spočívá chemický akt rozkladu cukru a jaká je jeho přesná příčina? Přiznám se, že to prostě nevím. — Louis Pasteur (8)

Pasteur použil baňky s labutí hrdlem (vpravo), aby prokázal, že živé částice ze vzduchu jsou zdrojem kontaminace-spíše než dříve zastávaná teorie spontánní generace

Pasteur pokračoval ve studiu fermentace a zjistil, že kvasinky přeměňují cukry na alkohol a že „kyselý“ účinek řepné šťávy je důsledkem kontaminace bakteriálními druhy, které jsou schopné přeměňovat ethanol na kyselinu octovou. K eliminaci možných bakteriálních kontaminantů byl Pasteur průkopníkem techniky, kde byly vzorky po určitou dobu zahřívány na konkrétní teplotu. Tento proces, známý jako pasterizace, je dodnes široce používán.

Přestože se bylo ještě co učit, hlavní principy Pasteurovy práce na fermentaci byly průkopnické. Na tomto vědeckém příběhu vycházel Moritz Traube, německý chemik, který v roce 1877 navrhl, aby fermentace byla kaskádou chemických událostí, kdy se kyslík přenáší z jedné části molekuly cukru do druhé, což vede k vysoce oxidovanému produktu (CO2 ) a vysoce redukovaný produkt ( tj. alkohol). Traube dále navrhl, že každá chemická událost ve fermentační sekvenci je katalyzována látkou podobnou proteinu (narážející na enzymy), což poskytuje pozoruhodné poznatky o buněčné chemii mnohem dříve než ostatní v oboru (1). O dvacet let později Eduard Buchner, také německý chemik, prokázal, že sacharózu lze fermentovat na alkohol pomocí kvasnicových extraktů, přičemž pro označení buněčné sloučeniny katalyzující tuto konverzi vytvořil termín „zymáza“. Buchnerova práce byla hodná Nobelovy ceny za chemii z roku 1907 a Pasteurův model upravil tak, aby zdůraznil myšlenku, že fermentace je funkcí živých, ale ne nutně dělících se buněk. Kromě toho Buchner ukázal, že fermentace je řetěz událostí, přičemž každý krok je katalyzován jiným enzymem (9).

Svou prací na vědeckém procesu kvašení Pasteur, Traube, Buchner a mnoho dalších vydláždilo cestu pro studium chemie života, jinak známé jako biochemie, a otevřelo celou vědní oblast.

Fermentace: La vie sans l’air

Z biochemického hlediska je fermentace metabolický proces, při kterém se organické sloučeniny přeměňují na energii, bez zapojení oxidačního činidla. Jak výstižně navrhl Louis Pasteur, fermentace je „ la vie sans l'air, “Nebo„ život bez vzduchu “. Fermentace však není univerzální. Pokud jde o fermentační procesy, ve skutečnosti existuje neuvěřitelná rozmanitost, protože různé mikroorganismy obsahují různé mechanismy pro přeměnu glukózy na energii.

Jádrem buněčného dýchání, které může zahrnovat fermentaci, je vysoce konzervovaný proces glykolýzy. Prostřednictvím této desetikrokové reakce se molekula glukózy rozdělí na dvě molekuly pyruvátu. Glykolýza nevyžaduje kyslík a nachází se v každém živém organismu na Zemi, což naznačuje, že to byla jedna z prvních biochemických cest, které se vyvíjely. Osud pyruvátu je však dán přítomností nebo nepřítomností kyslíku. Když je přítomen kyslík, akceptor elektronů, pyruvát se převede do aerobních buněčných dýchacích cest — Krebsova cyklu a elektronového transportního řetězce — za vzniku ATP. V nepřítomnosti kyslíku však molekuly pyruvátu vstoupí do fermentační kaskády.

Některé mikroorganismy si vyvinuly úroveň metabolické flexibility, která jim umožňuje přepínat mezi aerobním dýcháním a fermentací. Tyto mikroorganismy jsou jako takové klasifikovány jako fakultativní anaeroby. Jiné mikroorganismy jsou však otráveny kyslíkem a mohou podstupovat pouze anaerobní dýchání. V tomto případě jsou mikroorganismy obligátní anaeroby. U fakultativních anaerobů i obligátních anaerobů proces fermentace slouží k recyklaci produktů glykolytické reakce a zajišťuje, že buňky mohou pokračovat v produkci ATP.

Zvažte vzorec pro glykolýzu:

Pokud není přítomen kyslík, je glykolýza mechanismem primární energie, který generuje 2 čisté molekuly ATP na molekulu glukózy. Kromě přístupu k cukru vyžaduje glykolýza koenzym nikotinamid adenin dinukleotid (NAD). Konkrétně glykolytický enzym glyceraldehyd fosfát dehydrogenáza (GAPDH) vyžaduje jako kofaktor NAD +, který se během enzymatické reakce redukuje na NADH. Buňky však nemají neomezenou dodávku NAD +, což představuje problém pro výrobu energie. Proto je pro buňky opravdu důležité mít mechanismus, který oxiduje NADH zpět na NAD +. V mnoha organismech je toho dosaženo fermentací.

Aplikace fermentační chemie je mnoho a jsou rozmanité a přesahují kuchyň. Pro účely této diskuse se však zaměříme na fermentační reakce využívané pro kulinářské funkce, konkrétně produkci kyseliny mléčné a ethanolu.

Fermentace kyselinou mléčnou

Ke konverzi pyruvátu na kyselinu mléčnou dochází přímo prostřednictvím enzymatického působení laktátdehydrogenázy. V této reakci je pyruvát redukován na kyselinu mléčnou, zatímco NAD + je regenerován a vrácen zpět do glykolytické dráhy. The Lactobacillales řád, také známý jako Lactic Acid Bacteria (LAB), je soubor grampozitivních bakterií, které produkují kyselinu mléčnou na konci kaskád fermentace sacharidů. Mnoho druhů LAB se využívá k fermentaci potravin, protože okyselení růstového prostředí (mléko, solanka atd.) Brání růstu dalších mikroorganismů, které mohou „kazit“ jídlo. Kvašení kyseliny mléčné jako takové používá po staletí k uchovávání potravin nespočet kultur. Nedávno se ukázalo, že bakterie LAB jsou všudypřítomnou součástí zdravého profilu mikroflóry v lidském střevním traktu, což přispívá k jejich proslulosti. Běžné potraviny obsahující LAB jsou jogurt, kimchi, kysané zelí a lambické pivo.

Fermentace ethanolem

Transformace pyruvátu na ethanol a oxid uhličitý probíhá ve dvou krocích. Za prvé, karboxylová skupina je odstraněna z pyruvátu pyruvát dekarboxylázou za vzniku acetaldehydu a oxidu uhličitého (v tomto kroku mohou být syceny alkoholické nápoje). Poté se acetaldehyd převede na ethanol působením alkoholdehydrogenázy, která paralelně produkuje NAD + — a poskytuje nezbytný substrát pro pokračování glykolýzy. Kvasinky jsou velmi důležité fakultativní anaeroby, protože jsou velmi účinné při výrobě etanolu, což lidem umožňuje „chytit bzukot“ při pití nápojů, jako je víno a pivo. Kromě toho je tento proces nezbytný pro výrobu chleba. Zatímco většina ethanolu se vaří z chleba, uvolňování CO2 během procesu ethanolového kvašení jsou bochníky nadýchané.

Z kulinářského hlediska to vytváří příležitost k vytvoření široké škály potravinářských produktů a chuťových profilů. Mnozí z nás si užili plodů práce mikroorganismů a odhaduje se, že až jedna třetina všech potravin spotřebovaných lidmi na planetě Zemi je fermentována (10). Nakládané okurky, olivy, chléb, pivo, víno, čokoláda, káva, ocet, sójová omáčka ... Všechna tato lahodná jídla, stejně jako mnoho a mnoho dalších druhů fermentů, jsou výsledkem převádění pyruvátu do nějaké fermentační kaskády. Kuchyňské fermentory někdy využívají proces „divokého kvašení“, při kterém využívají přirozenou sbírku mikroorganismů přítomných v potravinách k vytvoření konkrétního kulinářského výsledku. Jindy se k vytvoření specifických fermentovaných potravinářských produktů používá dobře definovaná a charakterizovaná počáteční kultura. Je třeba zmínit, že fermentace je také užitečná v průmyslových podmínkách a mnoho biotechnologických společností vlévá neuvěřitelné zdroje do výzkumu a vývoje průmyslové fermentace ( tj. biopalivo).

Bez ohledu na strategii je důležité si uvědomit, že mikroorganismy v přírodě v monokultuře neexistují - což znamená, že v jakémkoli ekologickém prostředí existuje řada druhů mikroorganismů, které žijí a pracují společně v reakci na své podmínky prostředí.


Další řešení učebnic vědy

Biologie: Jednota a rozmanitost života (seznam kurzů MindTap)

Biologie: Dynamická věda (seznam kurzů MindTap)

Biologie člověka (seznam kurzů MindTap)

Human Heredity: Principles and Issues (MindTap Course List)

Biologie: Jednota a rozmanitost života (seznam kurzů MindTap)

Kardiopulmonální anatomie a fyziologie zesilovače

Biologie (seznam kurzů MindTap)

Obecná chemie - samostatná kniha (seznam kurzů MindTap)

Oceánografie: Pozvánka do mořské vědy, verze s volnými listy

Výživa: Pojmy a kontroverze - samostatná kniha (seznam kurzů MindTap)

Fyzika pro vědce a inženýry: základy a spojení

Environmentální věda (seznam kurzů MindTap)

Fyzika pro vědce a inženýry

Základy astronomie (seznam kurzů MindTap)

Základy fyzické geografie

Fyzika pro vědce a inženýry s moderní fyzikou

Výživa v průběhu životního cyklu

Organická a biologická chemie

Chemie pro dnešek: Obecná, organická a biochemie

Úvodní chemie: Nadace

Chemie: Principy a reakce

Environmentální věda (seznam kurzů MindTap)

Chemie a chemická reaktivita

Obecná, organická a biologická chemie

Úvod do obecné, organické a biochemie

Porozumění výživě (seznam kurzů MindTap)

Chemie pro studenty inženýrství

Chemie pro studenty inženýrství

Úvod do fyzikální vědy

Horizons: Exploring the Universe (MindTap Course List)

Chemie: První přístup k atomům

Fyzika pro vědce a inženýry, aktualizace technologie (nejsou zahrnuty žádné přístupové kódy)


Kvašení

Mnoho buněk není schopno dýchat kvůli jedné nebo více z následujících okolností:

  1. Buňce chybí dostatečné množství jakéhokoli vhodného anorganického konečného akceptoru elektronů k provádění buněčného dýchání.
  2. Buňka postrádá geny, aby mohla vytvářet vhodné komplexy a nosiče elektronů v elektronovém transportním systému.
  3. Buňce chybí geny k výrobě jednoho nebo více enzymů v Krebsově cyklu.

Zatímco nedostatek vhodného anorganického akceptoru konečných elektronů je závislý na životním prostředí, další dvě podmínky jsou geneticky dány. Mnoho prokaryot, včetně členů klinicky důležitého rodu Streptococcus, jsou trvale neschopní dýchat, a to i za přítomnosti kyslíku. Naopak mnoho prokaryot je fakultativních, což znamená, že pokud by se podmínky prostředí změnily a poskytly vhodný anorganický konečný akceptor elektronů pro dýchání, organismy obsahující všechny geny k tomu potřebné se přepnou na buněčné dýchání pro metabolismus glukózy, protože dýchání umožňuje mnohem větší ATP produkce na molekulu glukózy.

Pokud nedojde k dýchání, musí být NADH znovu oxidován na NAD +, aby mohl být znovu použit jako elektronový nosič pro glykolýzu, jediný mechanismus buňky produkující jakýkoli ATP. Některé živé systémy používají organickou molekulu (běžně pyruvát) jako konečný akceptor elektronů prostřednictvím procesu zvaného kvašení. Fermentace nezahrnuje elektronový transportní systém a nevytváří přímo žádný další ATP nad rámec toho, který vzniká během glykolýzy fosforylací na úrovni substrátu. Organismy provádějící fermentaci, nazývané fermentory, produkují během glykolýzy maximálně dvě molekuly ATP na glukózu. Tabulka 1 porovnává konečné akceptory elektronů a způsoby syntézy ATP v aerobním dýchání, anaerobním dýchání a fermentaci. Všimněte si, že počet molekul ATP ukázaných pro glykolýzu předpokládá Stezka Embden-Meyerhof-Parnas. Počet molekul ATP vyrobených fosforylace na úrovni substrátu (SLP) proti oxidativní fosforylace (OP) jsou indikovány.

Mikrobiální fermentační procesy byly manipulovány lidmi a jsou široce používány při výrobě různých potravin a dalších komerčních produktů, včetně léčiv. Mikrobiální fermentace může být také užitečná pro identifikaci mikrobů pro diagnostické účely.

Fermentace některými bakteriemi, jako jsou ty v jogurtu a jiných zakysaných potravinách, a zvířaty ve svalech během vyčerpání kyslíku, je fermentace kyseliny mléčné. Chemická reakce fermentace kyseliny mléčné je následující:

Bakterie několika grampozitivních rodů, včetně Lactobacillus, Leuconostoc, a Streptococcus, souhrnně známé jako bakterie mléčného kvašení (LAB), a různé kmeny jsou důležité při výrobě potravin. Během jogurt a sýr produkce, vysoce kyselé prostředí generované fermentací kyseliny mléčné denaturuje proteiny obsažené v mléce, což způsobuje jeho ztuhnutí. Když je jediným produktem kvašení kyselina mléčná, proces se říká homolaktické kvašení takový je případ Lactobacillus delbrueckii a S. termofilové používá se při výrobě jogurtů. Mnoho bakterií však funguje heterolaktická fermentaceprodukující směs kyseliny mléčné, ethanolu a/nebo kyseliny octové a CO2 jako výsledek, kvůli jejich použití rozvětvené pentózofosfátové dráhy místo EMP dráhy pro glykolýzu. Jedním z důležitých heterolaktických fermentorů je Leuconostoc mesenteroides, který se používá ke kynutí zeleniny, jako jsou okurky a zelí, k výrobě okurek a kysaného zelí.

Bakterie mléčného kvašení jsou důležité i z lékařského hlediska.Produkce prostředí s nízkým pH v těle brání usazování a růstu patogenů v těchto oblastech. Například vaginální mikrobiota je složena převážně z bakterií mléčného kvašení, ale když jsou tyto bakterie redukovány, kvasinky se mohou množit a způsobit kvasinkovou infekci. Bakterie mléčného kvašení jsou navíc důležité pro udržení zdraví gastrointestinálního traktu a jako takové jsou primární složkou probiotik.

Další známý proces fermentace je alkoholové kvašení, která vyrábí ethanol. Reakce fermentace ethanolu je znázorněna na obrázku 1. V první reakci je to enzym pyruvát dekarboxyláza odstraní karboxylovou skupinu z pyruvátu a uvolní CO2 plyn při výrobě molekuly dvou uhlíku acetaldehydu. Druhá reakce, katalyzovaná enzymem alkoholdehydrogenázou, přenáší elektron z NADH na acetaldehyd, přičemž vzniká ethanol a NAD +. Ethanolová fermentace pyruvátu kvasinkami Saccharomyces cerevisiae se používá při výrobě alkoholických nápojů a také způsobuje vzestup chlebových výrobků díky CO2 Výroba. Mimo potravinářský průmysl je fermentace rostlinných produktů ethanolem důležitá biopalivo Výroba.

Obrázek 1. Zde jsou uvedeny chemické reakce alkoholové fermentace. Fermentace ethanolu je důležitá při výrobě alkoholických nápojů a chleba.

Kromě fermentace kyselinou mléčnou a alkoholové fermentace se v prokaryotech vyskytuje mnoho dalších fermentačních metod, vše za účelem zajištění adekvátního přísunu NAD + pro glykolýzu (tabulka 2). Bez těchto cest by ke glykolýze nedocházelo a z rozkladu glukózy by nebyl získán žádný ATP. Je třeba poznamenat, že většina forem kvašení kromě homolaktické kvašení produkují plyn, obvykle CO2 a/nebo plynný vodík. Mnoho z těchto různých typů fermentačních cest se také používá při výrobě potravin a každá vede k produkci různých organických kyselin, což přispívá k jedinečné chuti konkrétního fermentovaného potravinářského produktu. Kyselina propionová produkovaná během fermentace kyseliny propionové přispívá například k výrazné chuti švýcarského sýra.

Několik fermentačních produktů je komerčně důležitých mimo potravinářský průmysl. Například chemická rozpouštědla jako např aceton a butanol jsou vyráběny během fermentace aceton-butanol-ethanol. Vytvářejí se komplexní organické farmaceutické sloučeniny používané v antibiotikách (např. Penicilin), vakcínách a vitaminech smíšené kyselé kvašení. Fermentační produkty se používají v laboratoři k diferenciaci různých bakterií pro diagnostické účely. Například enterické bakterie jsou známé svou schopností provádět smíšenou kyselou fermentaci, která snižuje pH, což lze detekovat pomocí indikátoru pH. Podobně lze také detekovat bakteriální produkci acetoinu během fermentace butandiolu. Produkci plynu z fermentace lze také vidět v obrácené Durhamově trubici, která zachycuje vyrobený plyn v kultuře vývaru.

Mikroby lze také rozlišovat podle substrátů, které mohou fermentovat. Například, E-coli může kvasit laktózu a tvořit plyn, zatímco někteří její blízcí gramnegativní příbuzní ne. Schopnost fermentovat cukerný alkohol sorbitol se používá k identifikaci patogenního enterohemoragického kmene O157: H7 E-coli protože na rozdíl od ostatních E-coli kmeny, není schopen fermentovat sorbitol. A konečně, fermentace mannitolu odlišuje fermentaci manitolu Staphylococcus aureus z jiných stafylokoků nemající fermentaci mannitolu.

Tabulka 2. Běžné cesty kvašení
Cesta Koncové produkty Příklad mikrobů Komerční produkty
Aceton-butanol-ethanol Aceton, butanol, ethanol, CO2 Clostridium acetobutylicum Komerční rozpouštědla, alternativa k benzínu
Alkohol Ethanol, CO2 Candida, Saccharomyces Pivo, chléb
Butandiol Acetin 2,3 -butandiol CO, kyselina mravenčí a kyselina mléčná2 plynný vodík Klebsiella, Enterobacter Chardonnay víno
Kyselina máselná Kyselina máselná, CO2, plynný vodík Clostridium butyricum Máslo
Kyselina mléčná Kyselina mléčná Streptococcus, Lactobacillus Kysané zelí, jogurt, sýr
Smíšená kyselina Ethanol, kyselina octová, mravenčí, mléčná a jantarová, CO2, plynný vodík Escherichia, Shigella Ocet, kosmetika, léčiva
Kyselina propionová Kyselina octová, kyselina propionová, CO2 Propionibacterium, Bifidobacterium švýcarský sýr

Přemýšlej o tom

  • Kdy by metabolicky všestranný mikrob prováděl fermentaci spíše než buněčné dýchání?

Identifikace bakterií pomocí testovacích panelů API

Identifikace mikrobiálního izolátu je zásadní pro správnou diagnostiku a vhodnou léčbu pacientů. Vědci vyvinuli techniky, které identifikují bakterie podle jejich biochemických charakteristik. Typicky buď zkoumají použití specifických zdrojů uhlíku jako substrátů pro fermentaci nebo jiné metabolické reakce, nebo identifikují produkty fermentace nebo specifické enzymy přítomné v reakcích. V minulosti mikrobiologové používali k provádění biochemických testů jednotlivé zkumavky a destičky. Vědci, zejména v klinických laboratořích, však nyní častěji používají plastové, jednorázové, více testovací panely, které obsahují řadu miniaturních reakčních zkumavek, z nichž každá obvykle obsahuje specifický substrát a indikátor pH. Po naočkování testovacího panelu malým vzorkem dotyčného mikroba a inkubaci mohou vědci porovnat výsledky s databází, která obsahuje očekávané výsledky pro specifické biochemické reakce pro známé mikroby, což umožňuje rychlou identifikaci mikrobu vzorku. Tyto testovací panely umožnily vědcům snížit náklady a současně zlepšit účinnost a reprodukovatelnost provedením většího počtu testů současně.

Mnoho komerčních, miniaturizovaných biochemických testovacích panelů pokrývá řadu klinicky důležitých skupin bakterií a kvasinek. Jedním z prvních a nejoblíbenějších testovacích panelů je panel Analytical Profile Index (API) vynalezený v 70. letech minulého století. Jakmile byla provedena určitá základní laboratorní charakterizace daného kmene, jako je například stanovení morfologie kmene kmene, lze použít vhodný testovací proužek, který obsahuje 10 až 20 různých biochemických testů pro diferenciaci kmenů v rámci této mikrobiální skupiny. V současné době různé API proužky lze použít k rychlé a snadné identifikaci více než 600 druhů bakterií, aerobních i anaerobních, a přibližně 100 různých druhů kvasinek. Na základě barev reakcí, kdy jsou přítomny metabolické konečné produkty, se v důsledku přítomnosti indikátorů pH z výsledků vytvoří metabolický profil (obrázek 2). Mikrobiologové pak mohou porovnat profil vzorku s databází a identifikovat konkrétního mikroba.

Obrázek 2. Testovací proužek API 20NE se používá k identifikaci specifických kmenů gramnegativních bakterií mimo Enterobacteriaceae. Zde je výsledek testovacího proužku API 20NE pro Photobacterium damselae ssp. piscicida.

Klinické zaměření: Alex, část 2

Tento příklad pokračuje v Alexově příběhu, který začal v Energy Matter a Enzymes.

Mnoho Alexových symptomů je v souladu s několika různými infekcemi, včetně chřipky a zápalu plic. Jeho pomalé reflexy spolu s jeho citlivostí na světlo a ztuhlým krkem však naznačují určité možné zapojení centrálního nervového systému, což pravděpodobně naznačuje meningitida. Meningitida je infekce mozkomíšního moku (CSF) kolem mozku a míchy, která způsobuje zánět mozkových blan, ochranných vrstev pokrývajících mozek. Meningitida může být způsobena viry, bakteriemi nebo houbami. Ačkoli jsou všechny formy meningitidy závažné, bakteriální meningitida je obzvláště závažná. Bakteriální meningitida může být způsobena několika různými bakteriemi, ale bakteriemi Neisseria meningitidisgramnegativní diplokok ve tvaru fazolí je běžnou příčinou a vede k úmrtí do 1 až 2 dnů u 5% až 10% pacientů.

Vzhledem k potenciální závažnosti Alexových podmínek jeho lékař doporučil rodičům, aby ho odvezli do nemocnice v gambijském hlavním městě Banjul a nechali ho otestovat a léčit na možnou meningitidu. Po 3 hodinách jízdy do nemocnice byl Alex okamžitě přijat. Lékaři odebrali vzorek krve a provedli bederní punkci, aby otestovali jeho mozkomíšní mok. Rovněž mu okamžitě zahájili léčbu antibiotikem ceftriaxonem, lékem volby pro léčbu meningitidy způsobené N. meningitidis, bez čekání na výsledky laboratorních testů.

  • Jak by mohlo být použito biochemické testování k potvrzení identity N. meningitidis?
  • Proč se Alexovi lékaři rozhodli podávat antibiotika bez čekání na výsledky testů?

K Alexovu příkladu se vrátíme na dalších stránkách.

Klíčové pojmy a shrnutí

  • Fermentace využívá organickou molekulu jako konečný akceptor elektronů k regeneraci NAD + z NADH, takže glykolýza může pokračovat.
  • Fermentace nezahrnuje elektronový transportní systém a fermentací se přímo nevyrábí ATP. Fermentory produkují velmi málo ATP - pouze dvě molekuly ATP na molekulu glukózy během glykolýzy.
  • Mikrobiální fermentační procesy byly použity pro výrobu potravin a léčiv a pro identifikaci mikrobů.
  • Během fermentace kyselinou mléčnou přijímá pyruvát elektrony z NADH a redukuje se na kyselinu mléčnou. Probíhající mikrobi homolaktické kvašení produkují pouze kyselinu mléčnou, jak fungují mikrobi fermentačního produktu heterolaktická fermentace produkovat směs kyseliny mléčné, ethanolu a/nebo kyseliny octové a CO2.
  • Produkce kyseliny mléčné normální mikroflórou brání růstu patogenů v určitých oblastech těla a je důležitá pro zdraví gastrointestinálního traktu.
  • Během ethanolové fermentace je pyruvát nejprve dekarboxylován (uvolňuje CO2) na acetaldehyd, který poté přijímá elektrony z NADH a redukuje acetaldehyd na ethanol. Fermentace etanolem se používá k výrobě alkoholických nápojů, k výrobě chlebových výrobků a k výrobě biopaliv.
  • Fermentační produkty cest (např. Fermentace kyselinou propionovou) poskytují potravinářským výrobkům výraznou chuť. Fermentace se používá k výrobě chemických rozpouštědel (fermentace aceton-butanol-ethanol) a léčiv (fermentace směsnou kyselinou).
  • Specifické typy mikrobů lze odlišit jejich fermentačními cestami a produkty. Mikroby lze také rozlišovat podle substrátů, které jsou schopny kvasit.

Vícenásobná volba

Který z následujících účel fermentace je?

  1. udělat ATP
  2. k výrobě meziproduktů molekul uhlíku pro anabolismus
  3. udělat NADH
  4. aby NAD +

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″] Odpověď d. Účelem fermentace je vytvořit NAD +. [/Hidden-answer]

Která molekula obvykle slouží jako konečný akceptor elektronů během fermentace?

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″] Odpověď c. Pyruvát obvykle slouží jako konečný akceptor elektronů během fermentace. [/Skrytá odpověď]

Který fermentační produkt je důležitý pro kynutí chleba?

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″] Odpověď b. CO2 je důležité pro vzestup chleba. [/skrytá odpověď]

Který z následujících produktů není komerčně důležitý fermentační produkt?

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″] Odpověď b. Pyruvát není komerčně důležitý fermentační produkt. [/Skrytá odpověď]

Vyplň prázdná místa

Mikrobem zodpovědným za fermentaci ethanolu za účelem výroby alkoholických nápojů je ________.

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″] Mikrob zodpovědný za fermentaci ethanolu za účelem výroby alkoholických nápojů je droždí (Saccharomyces cerevisiae). [/skrytá odpověď]

________ vede k výrobě směsi fermentačních produktů, včetně kyseliny mléčné, ethanolu a/nebo kyseliny octové a CO2.

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″]Heterolaktická fermentace vede k výrobě směsi fermentačních produktů, včetně kyseliny mléčné, ethanolu a/nebo kyseliny octové a CO2. [/skrytá odpověď]

Fermentující organismy vytvářejí ATP procesem ________.

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″] Fermentující organismy vytvářejí ATP procesem glykolýza. [/skrytá odpověď]

Vhodný

Spojte fermentační cestu se správným komerčním produktem, který se používá k výrobě:

___ fermentace aceton-butanol-ethanol A. chléb
___ kvašení alkoholu b. léčiva
___ fermentace kyseliny mléčné C. švýcarský sýr
___ fermentace smíšené kyseliny d. jogurt
___ fermentace kyseliny propionové E. průmyslová rozpouštědla

[odhal-odpověď q = � ″] Zobrazit odpověď [/odhal-odpověď]
[skrytá odpověď a = � ″]

  1. Průmyslová rozpouštědla se vyrábějí fermentací aceton-butanol-ethanol.
  2. Chléb se vyrábí alkoholovým kvašením.
  3. Jogurt se vyrábí fermentací kyseliny mléčné.
  4. Farmaceutika se vyrábí smíšenou kyselou fermentací.
  5. Švýcarský sýr se vyrábí fermentací kyseliny propionové.

Přemýšlej o tom

  1. Proč jsou některé mikroby, včetně Streptococcus spp., neschopný provádět aerobní dýchání, a to ani za přítomnosti kyslíku?
  2. Jak lze fermentaci použít k odlišení různých typů mikrobů?
  3. Bakterie E-coli je schopen provádět aerobní dýchání, anaerobní dýchání a fermentaci. Kdy by to provedlo každý proces a proč? Jak se v každém případě vyrábí ATP?

Kyselý výlet

To, co brání úspěšné produkci zelených chemikálií z biomasy, je to, co po léta zpomalilo komerční biochemické zpracování biomasy na ethanol.

Někteří tomu říkají biologický inteligentní obranný mechanismus proti mikrobiálním infiltrátorům a rozkladačům. „Je to strukturální materiál přírody a je sestaven velmi bezpečně,“ říká Dennis Miller, profesor chemického inženýrství na Michiganské státní univerzitě. Dekonstrukce rostlinného materiálu, oddělení ligninu od celulózy a hemicelulózy za účelem využití cukrů s pěti a šesti uhlíky, je mnohem složitější než jiné formy využití biomasy, jako je štěpkování dřeva a jeho spalování v kotli na tuhá paliva. Profesor Lee Lynd z Dartmouth College říká, že „rekultivace celulózové biomasy“ je největší překážkou nákladově efektivního biorafinace. „Pokud se to vyřeší, je přeměna cukrů na ethanol a regenerace etanolu dobře zavedená,“ říká. "U organických kyselin existuje více výzev, včetně titru fermentace a regenerace produktu."

Někteří odborníci považují třídu sloučenin známých jako organické kyseliny za jednu z nejslibnějších skupin produktů, které pocházejí z fermentace biomasy. Studie National Renewable Energy Laboratory provedená před několika lety identifikovala osm z top 12 chemikálií s přidanou hodnotou z cukrů jako karboxylové kyseliny. Kyselina octová je příkladem karboxylové kyseliny. Když alkohol reaguje s kyselinou, vzniká ester. Jedním z běžných esterů v dnešním světě obnovitelných paliv je bionafta-methanol reagující s mastnými kyselinami za vzniku methylesterů.

Výrobci ethanolu za sucha mletého kukuřice jsou příliš obeznámeni s bakteriemi mléčného kvašení a kyselinou octovou, které nenápadně infiltrují proces výroby ethanolu a místo alkoholu fermentují cukry na kyseliny, čímž okrádají Saccharomyces cerevisiae o životně důležité živiny a minerály, čímž snižují výnos a mletí výroby na zastavit, dokud nebude kontaminace pod kontrolou. V továrně na kukuřičný ethanol se v obřích rafinériích používá pouze několik velkých fermentorů, ale lignocelulózová biochemická rafinerie by pravděpodobně měla mnohem více fermentorů, podle zprávy subdodavatelů, kterou pro NREL provedli Lynd a kol., S názvem „Strategická analýza biorafinerie: analýza biorafinérií “. Zní to: „Počet fermentorů v i středně velké biorafinérii je tak velký-větší než 25 pro mnoho návrhů-že náklady na fermentační kapacitu nezávisí na tom, zda je tato kapacita věnována jednomu produktu nebo několika výrobkům.“ Vzhledem k tomu by mohla biorafinerie snadno věnovat fermentor biochemické produkci kyseliny mléčné, octové nebo jantarové, která může být prodávána na volném trhu jako takovém nebo reagovat skluzným proudem primárního produktu biorafinerie, ethanolu, k výrobě různých užitečných esterů.

Ethyllaktát reaktivní destilací
Pro společnosti vyvíjející ethanology k fermentaci cukrů s pěti a šesti uhlíky je třeba se vypořádat s přirozenou tendencí těchto zvířat chtít produkovat kyseliny. Společnost s názvem TMO Renewables Ltd. vyvinula organismus s chutí na pět a šest uhlíkových cukrů a „vypnula“ geny v organismu, které produkují kyseliny mléčné a octové.

„Když se podíváte na některé organismy tam venku, některé z běžných produktů, které můžete získat a které příroda již navrhla, jsou fermentace na kyseliny,“ říká profesor chemického inženýrství a termodynamiky MSU Carl Lira. „Místo toho, abychom se pokoušeli přimět organismus k výrobě dalšího produktu, nechejte ho vyrobit organickou kyselinu, kterou chce vyrobit, a pak můžeme přijít na to, jak to převést na jiné meziprodukty.“ A přesně to udělali Lira, Miller a další profesoři MSU spolu s Richardem Glassem, viceprezidentem pro výzkum a vývoj Národní asociace pěstitelů kukuřice.

„Nebylo by úžasné, kdybychom mohli vzít produkt, který v současné době vyrábí petrochemický průmysl, a najít pro něj konkurenceschopného partnera-obnovitelného, ​​konkurenceschopného a ekologického,“ říká Glass. „To bylo naše poslání. Dostali jsme tam modelový systém, protože ethyl laktát se dnes komerčně vyrábí z petrochemie a víme přesně, co to stojí, protože model existuje.“ Projekt MSU-NCGA začal za fermentací a zahrnoval reakci oddělených proudů kyseliny mléčné a ethanolu. Nakonec vědci zamýšleli povolit dodatečné vybavení stávajících závodů na ethanolové kukuřice na suché mletí za účelem diverzifikace jejich úzké řady produktů, ale je také zcela použitelné pro koncept lignocelulózové biorafinerie. „Náš proces je nezávislý na surovinách,“ říká Miller. „Nezáleží na tom, jestli použijeme na výrobu kyseliny mléčné glukózu z kukuřičného zrna, nebo použijeme cukry z kukuřičného zrna nebo dřevní biomasy. Proud cukru použitý k výrobě ethanolu je stejný proud cukru, jaký bychom použili k výrobě mléčných kyselin . "

Ethyllaktát je esterová sloučenina odvozená z reakce ethanolu s kyselinou mléčnou. Podle Liry není dnes ethyl laktát široce používán kvůli jeho vysokým nákladům, ale má aplikace v elektronickém průmyslu pro výrobu mikroobvodů, hlavně proto, že je to čisté rozpouštědlo. Lira říká, že v době, kdy on a jeho kolegové pracovali na tomto projektu, jehož výsledky byly zveřejněny v roce 2007, se náklady na výrobu ethyl laktátu pohybovaly mezi 1,30 a 1,60 dolaru za libru. Výzkumníci MSU a NCGA byli schopni snížit tyto náklady na polovinu pomocí procesu nazývaného reaktivní destilace.

„Reaktivní destilace existuje už nějakou dobu-není to nic nového,“ říká Glass pro časopis Biomass Magazine. "Ale co je nového, je naše aplikace. Obecně je problémem reakcí to, že k jejich oddělení je musíte destilovat, a když je destilujete, máte body varu, které jsou velmi blízko sebe, velmi těžko se oddělují. Ale reaktivní destilace nám umožňuje vyrábět sloučeniny zvané hemiacetaly, které jsou v systému stabilní a mají body varu úplně jiné, než jaké by mohly být pro původní chemikálii. “ Jakmile je tedy destilace dokončena, může být hemiacetal rozbit a čistá sloučenina získána s vysokým procentem čistoty.

Glass nazývá chemii zapojenou do reaktivní destilace „elegantní“, protože je neobvykle účinná a jednoduchá. Miller říká, že z hlediska zařízení a energetiky je reaktivní destilace účinným způsobem, jak provádět řadu chemických reakcí. „Když se podíváte na konvenční zpracování, reakce jde částečně, pak se zastaví, částečně se zastaví a zastaví se a myšlenka reaktivní destilace spočívá v tom, že budete reakci neustále tlačit, dokud nebude kompletní,“ říká Miller.

V reaktivní destilační koloně se používají nejméně dva přívody, přičemž nejméně těkavé reakční činidlo, kyselina, vstupuje nahoru a těkavější ethanol vstupuje na dno. Cílem je poskytnout reaktivní zónu, kde se voda esteru a vedlejšího produktu pohybuje ve sloupci v opačných směrech. Tento proces vyžaduje dva sloupce, protože v roztoku kyselina mléčná tvoří oligomery a vědci poznamenávají, že přesné modelování chování oligomerů a rovnováhy fází směsi jsou integrálními aspekty návrhu tohoto konkrétního projektu. NCGA v současné době hledá společnosti, které by mohly mít zájem o koupi licence pro tento proces výroby ethyl laktátu, který může být dodatečně vybaven do továrny na ethanol na suché mletí.

Trhy a rozmanitost produktů
„Pokud vše, co vyrábíte z biorafinerie, je ethanol, je to pro rodící se průmysl v pořádku, ale v podstatě vše, co máte, je poník s jediným trikem,“ říká Glass. „Mým snem je integrovaná biorafinerie, kde jediným omezením je vaše představivost a schopnost vytvořit systém.“ Lira říká, že rafinerie ethanolu jsou jednorozměrné. „V biorafinérii opravdu chcete tu rozmanitost,“ říká. „Nyní je ale velkou snahou vytvořit jediný organismus-vytvořit jediný produkt-protože to zjednodušuje separaci po proudu, a pokud můžete vyrábět pouze ethanol, můžete design převést na systém na klíč.“ Slovo „na klíč“ nebylo spojeno s rafinériemi ethanolu na biomasu, jako je tomu v odvětví etanolu na bázi škrobu.

Klasický příklad: methylacetát versus ethyl laktát

Tento diagram porovnává hlavní rozdíly v postupu a konstrukci používané při petrochemické výrobě ethyl laktátu vlevo oproti mnohem jednoduššímu reaktivnímu destilačnímu postupu vpravo.
zdroj: MICHIGAN STATE UNIVERSITY

Glass říká, že z továrny na ethanol o velikosti 25 MM, by boční proud ethanolu 1 MMgy odkloněný k výrobě chemikálií, jako je ethyl laktát, mohl přinést stejné množství příjmů jako zbývajících 24 MMgy ethanolu prodávaného jako palivo. Člověk by se mohl divit, proč místo výroby méně hodnotného ethanolu neodvrátit více ethanolu a nevyrobit ještě více chemikálií s přidanou hodnotou. Problém je v tom, že trhy jsou křehké a to, co by někteří mohli považovat za malé zvýšení výroby, by mohlo tlačit ceny dolů. Například použití ethyl -laktátu ve Spojených státech se pohybuje mezi 10 miliony a 20 miliony liber ročně a podle MSU se prodává za přibližně 1,50 USD za libru. „Mějte na paměti, že tam jsou někteří velcí hráči a pokud přijdete a pokusíte se jim vzít jejich trh, co se budou snažit dělat?“ Skleněné pózy. „Nebudou šťastní.“ Společnost Natureworks LLC provozuje největší závod na výrobu kyseliny polymléčné na světě v Blairu v Neb., Který vyrábí 300 milionů liber ročně.

Podle zprávy s názvem „Výroba a trh kyseliny jantarové v Číně“ Čína produkuje asi čtvrtinu až třetinu světové kyseliny jantarové. Zpráva uvádí, že v dnešní Číně hrají hlavní výrobní metody elektrochemická redukce a hydrogenace. Globálně se většina kyseliny jantarové vyrábí fermentací, „což může výrazně snížit výrobní náklady,“ uvádí zpráva. Lira říká, že velká část dnes vyráběné kyseliny octové se vyrábí z methanolové suroviny-methanu, methanolu až kyseliny octové. „Kyselinu octovou lze také vyrobit fermentací, ale nejsem si jistý, jak nákladově konkurenceschopná je v ropném procesu,“ říká Lira. „Nyní pracujeme na kyselinách jantarových, ale zatím o tom nemohu sdílet podrobnosti, protože práce stále pokračují.“ Práce zahrnuje esterifikaci kyseliny jantarové ethanolem za vzniku diethylsukcinátu.

Vzhledem k tomu, že mnoho z těchto kyselin je vyráběno jinými způsoby než fermentací, poskytne to biorefinériím postaveným na biochemické platformě velkou příležitost k diverzifikaci toků produktů. Zásadní součástí tohoto přístupu by však byl rozvoj nových trhů s organickými kyselinami a esterovými sloučeninami. „Velká lekce, kterou se učíme, je definování trhů,“ říká Lira. „To bude velká výzva prolomení trhů, nalezení společností, které budou první, kdo využije těchto příležitostí.“


Molekulární, vegetativní zvířecí zvíře

[The Leaven - zkoumání vztahu mezi vědou a náboženstvím (pokračování)]

Kvasinky jsou domestikovaný organismus, který se v moderní společnosti stal téměř nepostradatelným. Přestože jsou regály supermarketů pro základní dietu nepodstatné, jsou přeplněné produkty, které vyžadují fermentaci kvasinek. Výroba chleba, čokolády a alkoholu zahrnuje metabolickou aktivitu těchto jednoduchých jednobuněčných mikrobů. Kolem kvasnicových produktů se točí restaurace, bary, kluby a mnoho aspektů sociálního chování.

V průběhu staletí se kvasnice staly ohniskem domácího a průmyslového života. Zatímco fermentační schopnost byla středem zájmu mnoha různých hypotéz a posunů paradigmatu. Kdysi se předpokládalo, že fermentace je důsledkem chemické reakce nějakého druhu látky, a nikoli metabolické aktivity živého organismu. Během biblické éry by neexistovala představa, že by metabolická cesta mikroskopické štěnice byla zdrojem kvašení.

Kvasinky jsou přirozeně hojné v prostředí, zejména v půdě, kde jsou přenášeny hmyzem nebo jinými prostředky na slupky ovoce a zvířat, včetně lidí. Prostředí obsahuje mnoho různých druhů kvasinek, od těch, které způsobují houbové infekce (Candida spp.) ostatním, kteří se používají v pekárenském průmyslu a při výrobě vína (Saccharomyces spp.). Kvasinky patří do království Houby a divize Ascomycota. V poslední době se stala významným hráčem v biologickém výzkumu a nyní je jedním z nejvíce studovaných organismů na Zemi. Jednalo se o první eukaryotický organismus, který měl plně sekvenovaný genom. Většina jejích genů byla prozkoumána a funkčně analyzována, a protože mnohé z nich mají analogy v jiných mnohobuněčných organismech, je proto možné studovat molekulární procesy ze savčích systémů v rámci jednobuněčného modelu eukaryota. Je také dobře zavedený jako výhodná alternativa k systémům zvířecích modelů.

Rozsáhlé experimenty zahrnující počítače, robotiku a nové molekulární techniky, jako je polymerázová řetězová reakce (PCR) za účelem zesílení genů a mikročipů DNA, které uspořádaly stovky těchto genů do malé mřížky, vygenerovaly tak velké množství dat, že vyvinuly se nové vědní obory, např. genomika, transkriptomika, aby to vše bylo zpracováno do smysluplných výsledků. Díky jednoduchosti životního cyklu kvasinek je neocenitelný pro lékařský a biotechnologický výzkum. Jistě, kvasinky měly velký dopad na společnost 21. století, která způsobila sociální chování a lékařský výzkum. Pokud by tento organismus přestal existovat, antropologie by se vyvinula jinak.


Podívejte se na video: Sagorevanje etanola i benzena, Hemija, Eksperimenti (Listopad 2021).