Informace

Proč Alu repeats tvoří sekundární struktury?


Udělal jsem hodně výzkumu opakování Alu a toho, jak zprostředkovávají genovou expresi. Přečetl jsem si následující článek „Užitečný odpad: Alu RNA v lidském transkriptomu“.

A říká, že alu repetice vložené do 5'UTR vytváří stabilní sekundární strukturu, která brání sestavení ribozomálních podjednotek, čímž blokuje proces translace. Četl jsem různé články, abych zjistil, proč opakování Alu tvoří tuto sekundární strukturu a proč pouze v 5'UTR a ne v 3'UTR. Ale nebyl schopen najít odpověď.


Jednovláknová RNA může snadno tvořit sekundární struktury, velmi důležitým příkladem jsou tRNA.

Z rychlého pohledu na přečtený článek se zdá, že tyto Alu repetice fungují podobně jako riboswitche v 5'-UTR. Mohou tvořit sekundární struktury, které blokují iniciaci translace, riboswitchi to běžně dělají tím, že skrývají Shine-Dalgarnovu sekvenci ve stabilní šroubovici.

Tento druh regulace překladu může evidentně fungovat pouze v 5'-UTR, protože to je místo, kde překlad začíná. 3'-UTR nemůže ovlivnit překlad tímto způsobem, protože překlad začíná na druhém konci mRNA.

Alu repetice stále mohou tvořit sekundární struktury v 3'-UTR a článek naznačuje, že tyto mohou mít vliv na stabilitu mRNA.


Transpozony nebo skákající geny: typy, struktura, mechanismus a funkce

Pojďme provést hloubkovou studii transpozonů nebo skokových genů. Po přečtení tohoto článku se dozvíte o: 1. Úvod do transpozonů 2. Typy transpozonů 3. Struktura transpozonu 4. Cílová sekvence 5. Mechanismus transpozice 6. Funkce transpozonů 7. Formování nových genů a 8. Pseudogeny.

Úvod do transpozonů:

Dříve se mělo za to, že geny jsou statické a mají určitý a pevný lokus. V poslední době se však objevilo několik typů přeskupení genů a rekombinace. Segmenty DNA, které mohou přeskočit na cílová místa v genomu, poprvé objevila Barbara Mc Clintock. Zjistila, že kukuřice indické kukuřice má klasy s jádry různých barev.

Světle zbarvená jádra podle ní způsobil segment DNA, který skočil do genů kódujících pigmentovaná jádra, čímž pigmentovaná jádra deaktivovala. Tyto mobilní geny se nazývají transpozony nebo transponovatelné prvky.

Transpozony mohou skákat do genomu, což ovlivňuje expresi genů. Jsou zcela odlišné od vzájemných nebo homologních výměn DNA. Pohyb segmentů DNA se nazývá transpozice.

Jedná se o specifickou formu genetické rekombinace, která způsobuje pohyb určitých genetických prvků z jednoho místa DNA na druhé. Transpozony vložené do genu vedou k narušení jejich funkce. Když jsou vloženy do regulační sekvence genů, způsobují změnu genové exprese.

Transpozony jsou přítomny ve všech formách života. Jsou hlavními složkami mírně se opakující DNA. V lidských bytostech je více než 50% genomu složeno z transponovatelných prvků.

Typy transpozonů:

Transpozice probíhá dvěma způsoby:

1. Jednoduchá nereplikační transpozice:

Zahrnuje excizi transpozonu z jeho původního umístění do nového místa DNA. Toto je také známá transpozice vyjmutí a vložení.

2. Transpozice DNA replikačním mechanismem:

Transponovatelné segmenty generují novou kopii replikací. První kopie zůstane na původním místě a druhá kopie se přesune na nové místo kdekoli v genomu.

Pohyb na cílové místo vyžaduje rozbití chromozomu na novém místě a vložení transpozonu mezi dva generované konce. Enzymy potřebné k rozbití a opětovnému spojení chromozomu jsou přítomny v samotném transpozonu.

Struktura transpozonu:

Transpozony jsou úseky DNA, které mají na každém konci opakované segmenty DNA. Transpozon se skládá z centrální sekvence, která transponuje gen a další geny. To je na obou stranách lemováno krátkými opakujícími se segmenty DNA. Opakované segmenty mohou být přímé opakování nebo obrácené opakování. Tato koncová opakování pomáhají při identifikaci transpozonů.

Počet opakovaných nukleotidů je nerovnoměrný 5 nebo 7 nebo 9 nukleotidů je způsobeno jeho způsobem inzerce do cílového místa.

Cílová sekvence:

Místo, kde je vložen transpozon, se nazývá cílové místo nebo místo příjemce. Před přesunem transpozonu do cílového místa je cílová sekvence duplikována.

Dvě vytvořené kopie se od sebe vzdálí. Transpozon je vložen mezi dvě kopie cílových sekvencí.

Mechanismus transpozice:

Enzym transpozáza přítomná v samotném transpozonu vytváří zářezy nebo škrty v každém řetězci cílové sekvence. Cílová sekvence se duplikuje a dvě kopie se vzdálí, aby uvolnily místo transpozonu ve středu. Transpozon se poté zafixuje do dvou generovaných volných konců. Žlábky jsou utěsněny ligázou a dva prameny se stávají souvislými.

Funkce transpozonů:

Mutace způsobená transpozicemi:

Transpozony jsou vloženy do genů ovlivňujících jejich funkci, což způsobuje narušení jejich funkcí. Když jsou vloženy do regulační sekvence genů, způsobí změnu v jejich expresi. Jsou nejčastějším zdrojem mutací. Transpozony mohou vložit stop kodony, čímž produkují zkrácené proteiny.

U drosophilly je většina spontánních mutací způsobena transpozony skákajícími do genu. Mutantní bílooká drosphilla je produkována transponovatelným prvkem vloženým do genu, který normálně produkuje červený pigment.

Transpozony u lidí způsobují mnoho genetických chorob. Transpozony vedou k vývoji funkčního imunitního systému u obratlovců.

U bakterií jsou transponovatelné prvky přítomny na extra chromozomální DNA zvané plazmid. Transponovatelné prvky na plazmidech nesou geny pro proteiny, které ruší účinky antibakteriálních léčiv a toxinů.

Formování nových genů:

Jak buňky vytvářejí nové geny? Často se to děje mícháním exonů, ve kterém funkční jednotky dvou stávajících genů rekombinují a vytvářejí nový gen. Duplikace a divergence exonů také hraje svou roli při tvorbě nových genů.

Pseudogeny:

Transpozony přinášejí velkou flexibilitu genomu. Někdy duplikované geny a jiné transpozony nedokáží vytvořit funkční gen, a proto se stanou

Transpozony nebo skákající geny:

preudogeny nebo mrtvé produkty evoluce. Pseudogeny jsou v savčím genomu časté a nejsou schopné produkovat mRNA pro translaci.


Struktura beta

Struktura beta: Paralelní a antiparalelní beta vlákna jsou mnohem rozšířenější než alfa helixy (phi/psi -57, -47), ale ne tak rozšířená jako plně rozšířený polypeptidový řetězec (s úhly phi/psi +/- 180). Beta listy nejsou ukončeny tak rozšířené (paralelní -119, +113 antiparallel, -139, +135) a lze si je představit jako zvlněné listy. Lze je zobrazit tak, že vedle sebe položíte tenké skládané proužky papíru a vytvoříte „skládaný list“ papíru. Každý proužek papíru může být zobrazen jako jedno peptidové vlákno, ve kterém hlavní řetězec peptidu tvoří klikatě podél pásu, přičemž alfa uhlíky leží v záhybech záhybů. Každý jednotlivý řetězec beta listu může být zobrazen jako dvojitá šroubovice, tj. Šroubovice se 2 zbytky/otáčku. Uspořádání každé následující peptidové roviny je skládané kvůli tetraedrické povaze alfa C. Vazby H jsou meziřetězcové, nikoli intrařetězcové jako v alfa šroubovici.

Obrázek: Paralelní beta vlákna (obrázek vytvořený pomocí Spartanu)

Obrázek: Antiparallel beta vlákna (obrázek vytvořený pomocí Spartanu)

Zvažte vlákno jako spojitou a souvislou polypeptidovou páteř šířící se jedním směrem. Při použití této definice tedy spirála sestává z jednoho vlákna a všechny H-vazby jsou uvnitř vlákna (nebo intrařetězce). Beta list by se pak skládal z více vláken, protože každé "vlákno" je odděleno od ostatních "řetězců" intervenujícím souvislým úsekem aminokyseliny, který se ohýbá v proteinu způsobem, který umožňuje další část peptidové kostry, další "řetězec", na H -dluhopis s prvním & quot; pramenem & quot; Ale pamatujte si, že i v tomto případě jsou všechny H-vazby držící alfa a beta strukturu pohromadě intramolekulární.

V paralelní struktuře beta listu vede optimální vzor vazby H k méně rozšířené struktuře (phi/psi -119, +113) než optimální uspořádání vazeb H v antiparalelní struktuře (phi/psi -139, + 135). Také vazby H v rovnoběžném listu jsou výrazně ohnuty. (tj. karbonylový O na jednom řetězci není přesně naproti amidu H na sousedním řetězci, jak je tomu v antiparalelním listu.) Proto jsou antiparalelní beta vlákna pravděpodobně stabilnější, i když se oba v přírodě hojně vyskytují. Krátké paralelní beta listy se 4 vlákny nebo méně nejsou běžné, což může odrážet jejich nižší stabilitu.

Boční řetězy v beta listu jsou kolmé k rovině listu a vyčnívají z roviny na střídajících se stranách. Paralelní archy charakteristicky distribuují hydrofobní postranní řetězce na obou stranách listu, zatímco antiparalelní listy jsou obvykle uspořádány se všemi hydrofobními zbytky na jedné straně. To vyžaduje střídání hydrofilních a hydrofobních postranních řetězců v primární sekvenci. Antiparalelní listy se nacházejí v hedvábí, přičemž listy probíhají rovnoběžně s hedvábnými vlákny. Následující opakování se nachází v primární sekvenci: (Ser-Gly-Ala-Gly) n), přičemž Gly ukazuje z jedné tváře a Ser nebo Ala z druhé.

Beta vlákna mají tendenci se kroutit ve směru pravé ruky. To vede k důležitým důsledkům v propojení beta řetězců. Rovnoběžné prameny mohou tvořit zkroucené plechy nebo sedla i beta sudy.

Obrázek: Twisted Beta Sheet/Saddle (obrázek vytvořený pomocí VMD)

Obrázek: Beta Barrel (obrázek vytvořený pomocí VMD)

  • v paralelních vláknech je běžná konektivita pro praváky.
  • v proteinu s paralelním vláknem v rejstříku a vzhledem k inherentnímu zkroucení v porostech jsou vlákna uspořádána tak, aby vazby H byly na koncích řetězců nataženy rovnoměrně, což vedlo ke zkroucenému tvaru sedla (horní struktura výše) .

Jmol: Aktualizovaný zkroucený beta list od Arabinose Binding Protein Jmol14 (Java) | JSMol (HTML5)

  • v proteinu s paralelním vláknem mimo registr a vzhledem k inherentnímu kroucení v porostech se prameny uspořádají tak, aby vazby H byly natažené rovnoměrně na koncích řetězců, což vede k beta barelu (spodní struktura výše) .

Jmol: Beta barel z triosefosfát izomerázy


7.3: Prokaryotická replikace

  • Přispěl E. V. Wong
  • Axolotl Academica Publishing (Biology) ve společnosti Axolotl Academica Publishing

Replikace DNA začíná počátkem replikace. V prokaryotech je pouze jeden původ (v E-coli(oriC) a je charakterizována řadami opakovaných sekvencí. Tyto sekvence obalují protein vázající DNA a přitom vyvíjejí tlak na H-vazby mezi vlákny DNA a chromozom se začíná rozepínat v oblasti bohaté na AT obalené kolem tohoto proteinu. Pamatujte, že páry A-T jsou o 33% slabší než páry G-C kvůli menšímu počtu vodíkových vazeb. Použití úseků DNA bohaté na AT jako bodů oddělení vláken je opakujícím se tématem prostřednictvím řady operací DNA. Oddělení těchto dvou vláken je obousměrné a DNA polymerázy budou působit v obou směrech, aby byl proces dokončen co nejrychleji. Rychlost je zde důležitá, protože zatímco probíhá replikace, DNA je náchylná k rozbití a většina metabolických procesů je ukončena, aby byla věnována energie replikaci. Dokonce i u prokaryot, kde jsou molekuly DNA řádově menší než u eukaryotů, činí velikost molekuly DNA, když se odvíjí od ochranných obalových proteinů, vysoce náchylné k fyzickému poškození právě pohybem buňky.

První protein vázající OriC, DnaA, se váže na DnaA boxy, což je 9 segmentů párů bází s konsensuální sekvencí TTATCCACA. OriC má pět z těchto opakování a na každý z nich se váže jeden protein DnaA. HU a IHF jsou histonové proteiny, které se sdružují s DnaA a společně ohýbají tuto část DNA do kruhové smyčky, přičemž ji umístí těsně nad další hlavní rys oriC, opakování bohatá na AT o 13 bp (GATCTNTTNTTTT). DnaA hydrolyzuje ATP a láme H-vazby mezi vlákny v 13merových opakováních, známých také jako tání DNA. To umožňuje komplexy DnaB [a DnaC, což je zaváděcí protein, který pomáhá připojit DnaB (6) k řetězci za doprovodné hydrolýzy ATP. Rovněž je přijato dalších pět DnaA ke stabilizaci smyčky.] K navázání na každou jednovláknovou oblast DNA na opačných stranách nově otevřené replikační bubliny.

DnaB je a helikáza jeho enzymatickou aktivitou je rozbalit/rozvinout DNA před DNA polymerázou, aby jí poskytla jednovláknovou DNA ke čtení a kopírování. Činí tak ve spojení s jednovláknovými proteiny vázajícími DNA (SSB) a DNA gyrázou. Funkce SSB je téměř samovysvětlující: jednovláknová DNA je jako RNA ve své schopnosti vytvářet složité sekundární struktury interním párováním bází, takže SSB tomu brání. DNA gyráza je topoizomeráza typu II a má za úkol zavést do DNA negativní superšroubovice. To je nezbytné, protože rozbalení DNA pomocí helikázy ji také odvíjí (protože se jedná o dvojitou šroubovici) a způsobuje zavedení pozitivního supervinutí. To znamená, že se celá kruhová molekula kroutí sama na sebe: představte si, že držíte gumičku ve dvou rukou a kroutíte s ní. Jak se supercívka hromadí, DNA se stává pevněji stočenou, až je pro helikázu nemožné rozbalit ji. DnaB/gyráza může tento stres uvolnit dočasným rozříznutím dvouvláknové DNA, průchodem smyčky molekuly skrz mezeru a jejím opětovným uzavřením.

Obrázek ( PageIndex <8> ). Topoizomerázy DNA typu II, jako je DNA gyráza, uvolňují supervinutí dočasným přestřižením dvou vláken.

To (doufejme) dává mnohem větší smysl při pohledu na diagram. Nebo se vraťte k naší gumičce, udělejte gumičce jeden nebo dva kroužky a poté oba konce sepněte páskou. Pokud odstřihnete gumičku a protáhnete přilehlou část gumičky touto stříhačkou, poté znovu připojíte odstřižené konce, zjistíte, že došlo k menšímu zkroucení. Šikovný, co? V tuto chvíli někteří z vás řeknou, ale pokud otočíte volně plovoucí gumičku, jak by si někdo mohl představit volně plovoucí kruhový chromozom DNA v E-coli, očekávali byste, že se to přirozeně roztočí. Technicky ano, ale vzhledem k velké hmotnosti chromozomu, jeho asociaci s různými proteiny a buněčnou membránou a viskozitě prostředí se nechová, jako by byl zcela volný.

Obrázek ( PageIndex <9> ). Detail akce DNA topoizomerázy typu II. (A) Nejprve se enzym váže na DNA a iniciuje endonukleázovou aktivitu, přičemž v tomto bodě prořízne obě vlákna DNA. (B) Tento úplný průřez DNA (na rozdíl od jednovláknového rozříznutí topoizomerázami typu I) umožňuje další části stejné molekuly DNA proklouznout mezerou. (C) Nakonec dva dočasně zlomené konce DNA, které byly enzymem drženy těsně na svém místě.

Jakmile je oriC otevřen a helikázy jsou připojeny ke dvěma stranám replikační vidlice, replikačního stroje, aka se může začít tvořit doplněk. Než však DNA polymerázy zaujmou pozice, musí být připraveny. DNA polymerázy nejsou schopné spojit dva jednotlivé volné nukleotidy společně, aby se začala tvořit nukleová kyselina, se mohou přidat pouze na již existující vlákno alespoň dvou nukleotidů. Specializovaná RNA polymeráza (RNAP & rsquos toto omezení nemají) známá jako primasa je součástí replisomu a čte čte krátký řetězec RNA nazývaný základní nátěr pro přidání DNA polymerázy. Ačkoli je potřeba pouze několik nukleotidů, prokaryotické primery mohou být v závislosti na druhu až 60 nt.

Dosud bylo objeveno nejméně pět prokaryotických DNA polymeráz. Primární DNA polymeráza pro replikaci v E-coli je DNA polymeráza III (Pol III). Pol I je také zapojen do základního mechanismu replikace DNA, primárně do mezer vytvořených během syntézy zaostávajících vláken (definovaných 3 stránky dopředu) nebo prostřednictvím mechanismů opravujících chyby. DNA polymeráza II a nedávno objevený Pol IV a Pol V se neúčastní chromozomální replikace, ale spíše se používají k syntéze DNA, když jsou určité typy opravy potřeba jindy v průběhu buněčného životního cyklu.

DNA polymeráza III je holoenzym s více podjednotkami, s podjednotkami & alfa, & epsilon a & theta obsahující polymerázu jádra a & tau, & gama, &delta, &delta& rsquo, & chi, & Psi a & beta se spojují a tvoří kompletní holoenzym. Jádrová polymeráza má dvě aktivity: podjednotka & alfa je polymerázová funkce, čte vlákno DNA a syntetizuje komplementární vlákno velkou rychlostí, přibližně 150 nt/s je podjednotka & epsilon 3 & rsquo-5 & rsquo & ldquoproofreading & rdquo exonukleáza a funguje jako okamžitý korektor , odstranění posledního nukleotidu, pokud je nesprávný. Tato korektura nedosahuje dále: působí pouze na poslední přidaný nukleotid, aby opravil chybné začlenění. K nápravě lézí DNA, které vzniknou v jiné době, se používají jiné mechanismy a enzymy. [Pokud jde o nomenklaturu, exonukleázy odřízly pouze nukleotidy z DNA nebo RNA z obou konců, ale ne uprostřed. Endonukleázy štěpí fosfodiesterové vazby umístěné hlouběji v řetězci nukleové kyseliny.] Podjednotka & theta nemá žádnou enzymatickou aktivitu a reguluje funkci exonukleázy. Přestože má polymerázovou aktivitu, polymerová jádra Pol III má špatnou procesivitu - to znamená, že může přidat až 15 nukleotidů před disociací z templátové DNA. Vzhledem k tomu, genomy E-coli kmenů v průměru blízko 5 milionů párů bází, replikace v malých 15 nt segmentech by byla mimořádně neúčinná.

Obrázek ( PageIndex <10> ). Dimeric & beta svorka drží DNA polymerázu III na templátu, což jí umožňuje polymerizovat více nukleotidů před disociací.

Svorkový zavaděčový komplex je sestava ATPase, která se po navázání ATP váže na jednotku & beta-clamp (ale aktivita ATPázy není zapnutá). Když se komplex potom váže na DNA, aktivuje ATPázu a výsledná hydrolýza ATP vede ke konformačním změnám, které dočasně otevřou svorku (aby obkroužily nebo se odstěhovaly z řetězce DNA), a poté k disociaci zavíracího zavaděče z sestava svorky.

Zde je zapotřebí podjednotka & beta. Také známý jako & beta svorka, je to dimer půlkruhových podjednotek, který má centrální otvor, kterým je provlečena DNA. Jádrová polymeráza je prostřednictvím interakce alfa a beta připojena k této svorce beta tak, aby zůstala na DNA déle, čímž se zvyšuje účinnost Pol III na více než 5 000 n. Svorka & beta je naložena na DNA (a uvolněna z ní) komplexem klešťového zavaděče (nazývaného také & gamma komplex) sestávající z podjednotek & gamma (x3), & delta, & delta & rsquo, & chi a & Psi.

Replikační bublina má dvě replikační vidlice - jakmile se DNA otevře (rozepne) na počátku, může se na každém konci vytvořit replikační stroj, přičemž helikázy směřují opačným směrem. Pro zjednodušení budeme v této diskusi uvažovat pouze o otevření jedné vidlice a mdash zleva doprava & mdash s tím, že totéž se děje s druhou vidlicí, ale v opačném směru.

První věc, které si při pohledu na diagram replikační vidlice (Obrázek ( PageIndex <11> )) všimnete, je, že dvě jednovláknové části templátové DNA jsou antiparalelní. V tomto bodě kurzu by to nemělo být překvapením, ale přináší to zajímavý mechanický problém. Helikáza otevírá dvouvláknovou DNA a vede zbytek replikačního stroje. Pokud se tedy v jednovláknové oblasti za helikázou podíváme zleva doprava, jeden pramen šablony je 3 & rsquo až 5 & rsquo (modře), zatímco druhý je 5 & rsquo až 3 & rsquo (červeně). Protože víme, že nukleové kyseliny jsou polymerovány přidáním 5 & rsquo fosfátu nového nukleotidu k 3 & rsquo hydroxylu předchozího nukleotidu (5 & rsquo až 3 & rsquo, zeleně), znamená to, že jeden z vláken, nazývaný vedoucí vlákno, je syntetizován ve stejném směru, jakým se pohybuje replikační stroj. Žádný problém.

Druhé vlákno je problematické: při lineárním pohledu by nově syntetizované vlákno šlo 3 & rsquo na 5 & rsquo zleva doprava, ale DNA polymerázy nemohou takto přidávat nukleotidy. Jak buňky tento problém vyřeší? Byla navržena řada možností, ale zde je znázorněn současný model. Replikační stroj se skládá z helikázy, primáz a dvou holoenzymů DNA polymerázy III pohybujících se stejným fyzickým směrem (po helikáze). Ve skutečnosti jsou komplexy pol III fyzicky propojeny pomocí podjednotek & tau.

Obrázek ( PageIndex <11> ). Replikace DNA v prokaryotech.

Aby bylo možné replikovat vlákno šablony, které je 5 & rsquo až 3 & rsquo zleva doprava, musí být vlákno přiváděno do polymerázy zpět. Toho lze dosáhnout buď otočením polymerázy, nebo smyčkou DNA kolem. Jak ukazuje obrázek, současný model je ten, že se primasa pohybuje také zleva doprava, takže má jen krátký čas na rychlou syntézu krátkého primeru, než se bude muset pohybovat vpřed s replisomem a znovu se rozběhnout, přičemž v něm zůstanou přerušované primery jeho probuzení. Z tohoto důvodu je Pol III nucen syntetizovat najednou pouze krátké fragmenty chromozomu, po jejich objeviteli nazývané Okazakiho fragmenty. Pol III začíná syntetizovat přidáním nukleotidů na 3 & rsquo konec primeru a pokračuje, dokud nenarazí na 5 & rsquo konec dalšího primeru. Není (a nemůže) spojte syntetizovaný řetězec s koncem primeru 5 & rsquo.

Replikace DNA se nazývá polokontinuální proces, protože zatímco je hlavní vlákno syntetizováno kontinuálně, zaostávající vlákno je syntetizováno ve fragmentech. To vede ke dvěma zásadním problémům: za prvé, v nově vytvořených vláknech zůstávají malé kousky RNA (jen na 5 & rsquo konci pro vedoucí vlákno, na mnoha místech pro zaostávání) a za druhé, Pol III může přidat pouze volné nukleotidy k fragmentu jednovláknové DNA nemůže připojit další fragment. Nový & ldquostrand & rdquo proto není celý, ale prošpikovaný chybějícími fosfodiesterovými vazbami.

První problém je vyřešen DNA polymerázou I. Na rozdíl od Pol III je Pol I monomerní protein a působí samostatně, bez dalších proteinů. Existuje také 10–20krát více molekul Pol I než molekul Pol III, protože jsou potřebné pro tolik fragmentů Okazaki. DNA polymeráza I má tři aktivity: (1) jako Pol III, může syntetizovat řetězec DNA na základě DNA templátu, (2) také jako Pol III, je to 3 & rsquo-5 & rsquo korektura exonukleázy, ale na rozdíl od Pol III, (3 ) je to také exonukleáza 5 & rsquo-3 & rsquo. Aktivita exonukleázy 5 & rsquo-3 & rsquo je zásadní při odstraňování RNA primeru (obrázek ( PageIndex <12> )). Exonukleáza 5 & rsquo-3 & rsquo se váže na dvouvláknovou DNA, která má jednovláknové přerušení ve fosfodiesterové páteři, jako se to stane poté, co byly fragmenty Okazaki syntetizovány z jednoho primeru na druhý, ale nelze je spojit. Tato exonukleáza 5 & rsquo-3 & rsquo pak odstraní RNA primer. Polymerázová aktivita pak přidává nové DNA nukleotidy k upstream fragmentu Okazaki, vyplňuje mezeru vytvořenou odstraněním RNA primeru. Korektura exonukleázy funguje stejně jako u Pol III, okamžitě odstraní nově zabudovaný nesprávný nukleotid. Po korektuře je celková chybovost inkorporace nukleotidů přibližně 1 ze 107.

Technicky exonukleáza 5 & rsquo-3 & rsquo štěpí DNA v dvouvláknové oblasti za nickem a poté se může odstranit kdekoli od 1 do 10 n najednou. Experimentálně může být aktivita exonukleázy 5 & rsquo-3 & rsquo odštěpena od zbytku Pol I proteázou trypsinem. To generuje & ldquoKlenow fragment & rdquo obsahující polymerázu a 3 & rsquo-5 & rsquo korektorovou exonukleázu.


Obrázek ( PageIndex <12> ). Zpožďující syntéza vláken. Poté, co DNA polymeráza III rozšířila primery (žlutá), DNA polymeráza I odstraní primer a nahradí jej přidáním na předchozí fragment. Když dokončí odstranění RNA a nahradí ji DNA, opustí DNA chybějící fosfodiesterovou vazbou mezi DNA syntetizovanou pol III downstream a DNA syntetizovanou pol I proti proudu. Tento zlom v kostře cukr-fosfát je opraven DNA ligázou.

I když byla RNA nahrazena DNA, stále zůstává fragmentované vlákno. Nakonec se objeví poslední hlavní hráč v příběhu replikace DNA: DNA ligáza. Tento enzym má jeden jednoduchý, ale zásadní úkol: katalyzuje útok 3 & rsquo-OH z jednoho fragmentu na 5 & rsquo fosfát dalšího fragmentu a vytváří fosfodiesterovou vazbu. Tato reakce vyžaduje energii ve formě hydrolýzy buď ATP nebo NAD + v závislosti na druhu (E-coli používá NAD +) generující AMP a buď PP nebo NMN +.


Nekanonické struktury DNA založené na interakcích guanin -guanin zřejmě hrály roli v původu a evoluci telomer

Ve většině eukaryotických chromozomů jsou telomerové DNA sekvence pole krátkých opakujících se sekvencí bohatých na guanin, které končí v 3'-jednovláknovém převisu bohatém na G (150–200 nukleotidů). Vlákno bohaté na G je syntetizováno na telomeru specifickou RT, nazývanou telomeráza, za použití malé oblasti její podjednotky RNA jako templátu a 3'-OH na konci chromozomu jako primeru (Blackburn 1992). TTAGGG, nalezený u zvířat, hub a Amoebozoa, byl telomerickou jednoduchou opakující se sekvencí přítomnou v předcích Unikont. Navíc jeho výskyt u některých druhů superskupin Plantae, Chromalveolata, Excavata a Rhizaria naznačuje, že TTAGGG by mohla být rodová telomerická opakovaná sekvence pro eukaryoty (Fulnecková et al. 2013).

Na druhé straně použití prokaryotických retroelementů k zakořenění RT fylogenetického stromu ukazuje, že se zdá, že telomeráza se vyvinula z RT rodového retrotranspozonu bez LTR (Eickbush 1997). Dále se věří, že schopnost non-LTR RT používat 3'-OH chromozomových konců k primární reverzní transkripci byla klíčová pro zrod časných telomeráz (Moore a Haber 1996 Morrish et al. 2002, 2007 Curcio a Belfort 2007).

Telomery na bázi telomeráz přinesly dvě hlavní výhody: usnadněnou homeostázu telomer a větší strukturální ochranu začleněním jednoduchých opakování bohatých na G s vlastní schopností vytvářet G-kvadruplexní struktury (Henderson et al. 1987 Arthanari a Bolton 2003 Teixeira a Gilson 2005 ). G-kvadruplexy se skládají ze skládaných G-kvartet, což jsou rovinné uspořádání čtyř guaninů držených pohromadě vodíkovými vazbami Hoogsteen (Neidle 2009) (obr.2A). V terminálním 3'-převisu bohatém na G může dojít k tvorbě G-kvadruplexu (obr.2B) nebo když převis napadne sousední dvouvláknovou oblast telomer za vzniku struktur T-smyčky (obr.2C) (Maizels 2006 Rhodes 2006 Xu et al. 2008 Bochman et al. 2012). Přesto se předpokládalo, že po objevení telomerázy se udržování telomer pomocí primitivního mechanismu replikace T-smyčky stává méně relevantní (de Lange 2004). První vizualizace telomerické tvorby G-kvadruplexu in vivo byla provedena v ciliátu Stylonychia (Schaffitzel et al. 2001 Paeschke et al. 2005). V poslední době byla k vizualizaci G-kvadruplexních struktur na lidských telomerách použita vysoce specifická DNA G-kvadruplexní protilátka (Biffi et al. 2013).

Schematické diagramy G-kvarteta a dvou telomerických G-kvadruplexů. (A) Čtyři guaniny se shromáždí v rovinném uspořádání a vytvoří G-kvarteto. Vodíkové vazby jsou v přerušovaných čarách. (B) Schéma intramolekulárního G-kvadruplexu na konci telomer. (C) Schéma G-kvadruplexu na T-smyčce. G-kvadruplexy na obrázku jsou složeny ze tří skládaných G-kvartet (stínovaných čtverců).

Schematické diagramy G-kvarteta a dvou telomerických G-kvadruplexů. (A) Čtyři guaniny se shromáždí v rovinném uspořádání a vytvoří G-kvarteto. Vodíkové vazby jsou v přerušovaných čarách. (B) Schéma intramolekulárního G-kvadruplexu na konci telomer. (C) Schéma G-kvadruplexu na T-smyčce. G-kvadruplexy na obrázku jsou složeny ze tří skládaných G-kvartet (stínovaných čtverců).

Je důležité zdůraznit, že domnělá rodová telomerázou syntetizovaná sekvence (TTAGGG)n, je nejen schopen skládat se do G-kvadruplexní struktury, ale je také nejlepší v in vitro (Tran et al. 2011). Nedávné biofyzikální studie skládání těchto telomerických G-kvadruplexů navíc ukázaly, že tvorba struktury probíhá v milisekundách. Tyto kinetiky skládání jsou biologicky relevantní, protože jsou srovnatelné s transkripcí a replikací DNA (Zhang a Balasubramanian 2012).

Během evoluce vedly mutace v templátu telomerázové RNA ke vzniku opakujících se variant s různou délkou guaninových motivů (G2, G.4, a více). Nedávné experimenty zjistily, že G-kvadruplexy tvořené telomerickými opakováními pouze se dvěma po sobě následujícími guaniny (TTAGG u členovců a TTAGGC u nematodů) jsou v rovnováze s G-hairpiny a jinými nekanonickými strukturami (Tran et al. 2011).

V hedvábném můře Bombyx mori (Lepidoptera) a brouk moučný Tribolium castaneum (Coleoptera), telomerázová aktivita je slabá a telomerově specifické non-LTR retroelementy (TRAS a SART rodinné prvky v B. mori a SART rodinné prvky v T. castaneum) jsou vloženy do telomerických opakování specifickým způsobem (Fujiwara et al. 2005 Osanai et al. 2006), který zachovává předpojatost G/C vlákna (obr. 3). Masivní integrace těchto prvků do proximálních oblastí opakujících se polí TTAGG B. mori a TCAGG pole T. castaneum (alternativní telomerová varianta u hmyzu) dává vzniknout obrovským telomerám o velikosti větší než 200 kb.

Distribuce telomerických sekvencí v Bilaterii. Většina eukaryot má opakování syntetizovaná telomerázou bohatá na G se sousedními komplexními subtelomerickými opakováními nazývanými sekvence související s telomerami (TAS). Ve většině členovců jsou retrotranspozony specifické pro telomery vloženy do telomerázou syntetizovaných opakování. Jak je vidět na diagramu, TRAS prvky se vkládají v opačné orientaci než SART elementy. U předchůdce dipteanského hmyzu byl ztracen gen telomerázy (zelená čára). v Chironomus tentans (nižší Diptera), telomerické sekvence se skládají ze složitých tandemových opakování udržovaných rekombinací. Nicméně, Drosophila druhy mají více telomerově specifických retrotranspozonů (autonomních i neautonomních), které transponují na chromozomální konce. Událost odstranění v původním prvku TAHRE je zobrazena přerušovanými čarami.

Distribuce telomerických sekvencí v Bilaterii. Většina eukaryot má repetety syntetizované telomerázou bohaté na G se sousedními komplexními subtelomerickými repeticemi nazývanými sekvence související s telomerami (TAS). In most arthropods, telomere-specific retrotransposons are inserted into telomerase-synthesized repeats. As can be seen in the diagram, TRAS elements insert in reverse orientation to that of the SART elementy. In an ancestor of diptean insects, the telomerase gene was lost (green line). v Chironomus tentans (lower Diptera), the telomeric sequences consist of complex tandem repeats maintained by recombination. Nicméně, Drosophila species have multiple telomere-specific retrotransposons (autonomous and nonautonomous) that transpose to chromosomal ends. The deletion event in the ancestral TAHRE element is shown with dashed lines.

The telomeres of the honey bee Apis mellifera (Hymenoptera) are exceptional among the arthropods because they do not have non-LTR elements inserted into their telomeric repeats. Instead, the telomere sequence consists of TTAGG repeat arrays ( Robertson and Gordon 2006) interspersed with TCAGGCTGGG, TCAGGCTGGGTTGGG, and TCAGGCTGGGTGAGGATGGG higher order repeat arrays (Garavís M, Villasante A, unpublished results) ( fig. 3). These higher order repeats arose by amplification of the mutated repeats present in proximal telomeric regions and the interspersed pattern developed by further amplifications of the 5-bp repeat arrays together with higher order repeat arrays. However, the TTAGG repeats of Acyrthosiphon pisum (Hemiptera) and Pediculus humanus (Phthiraptera) contain insertions of non-LTR retrotransposons of the TRAS a SART family, respectively ( International Aphid Genomics Consortium 2010 Kirkness et al. 2010) ( fig. 3). As Hemiptera and Phthiraptera are basal to Hymenoptera, Coleoptera, Lepidoptera, and Diptera ( fig. 3), the telomeres of A. mellifera seem to represent a case where the TRAS a/nebo SART retrotransposons were lost at a later stage in evolution. It is tempting to speculate that the appearance of those higher order repeat arrays with propensity to form 3-quartet G-quadruplexes caused the decay, and eventual loss, of the telomeric retrotransposons.

Because the telomeres of the spider mite Tetranychus urticae (from the basal branch Chelicerata) are also a mosaic of short TTAGG repeats interrupted by non-LTR retrotransposons closely related to TRAS ( Grbić et al. 2011) ( fig. 3), the telomeres of the arthropods seem to be maintained by telomerase, by insertion of specific non-LTR retrotransposons into the TTAGG repeat array and by recombination. The same system of telomere maintenance has also been found in some nonarthropod species ( Arkhipova and Morrison 2001 Yamamoto et al. 2003 Gladyshev and Arkhipova 2007 Starnes et al. 2012). It has not escaped our notice that the appearance of this apparently suboptimal mechanism of telomere maintenance, which might have created chromosome instability, seems to have coincided with the great arthropod radiation into Chelicerata and Mandibulata.

On the other hand, certain yeasts from the Ascomycota phylum have telomeric repeats that are diverse in terms of their sequence, length, and homogeneity ( McEachern and Blackburn 1994). In these yeasts, the degenerate repeats result from the nonprocessivity of their telomerases ( Prescott and Blackburn 1997). Importantly, these repeats, despite their TG-richness, are less prone to fold into G-quadruplexes ( Tran et al. 2011), and it has been shown that in these organisms, the telomere-binding proteins are fast evolving ( Teixeira and Gilson 2005). Therefore, it is possible that these yeasts are using an ancestral system of chromosome end protection where the ssDNA-binding proteins facilitate the folding of the 3′-overhangs into G-quadruplex-like structures. This yeast-capping mechanism likely arose de novo by convergent evolution.

Do Noncanonical Secondary Structures Have a Role in the Maintenance of Telomeres without Telomerase?

Once telomerase becomes completely dysfunctional, the gene encoding telomerase could be lost if telomeres are maintained by the ancestral alternative mechanism of homologous recombination. Apparently, this is what happened in the ancestor of Diptera about 260 Ma ( Wiegmann et al. 2011). In the lower Diptera, Anopheles, Rhynchosciara, a Chironomus, long tandem repeats are present at chromosome ends, suggesting that telomere maintenance takes place by homologous recombination ( Nielsen and Edstrom 1993 Biessmann et al. 1998 Madalena et al. 2010) ( fig. 3). v Drosophila, however, telomere maintenance occurs primarily by transposition of telomere-specific retrotransposons to receding chromosome ends ( fig. 3). In addition to retrotransposition, Drosophila telomeres are also maintained, as in any eukaryote, by recombination/gene conversion ( Kahn et al. 2000).

v D. melanogaster, three telomeric retrotransposons TART, TAHRE, a HeT-A (a nonautonomous element derived from an ancestral TAHRE that loss its RT), transpose occasionally to chromosome ends using the free 3′-OH at chromosome termini to prime reverse transcription ( Biessmann et al. 1990, 1992 Sheen and Levis 1994 Abad et al. 2004a, 2004b). In agreement with this mechanism, the telomeric elements appear randomly mixed in head-to-tail arrangements and variably truncated at the 5′-end ( Mason et al. 2008 Villasante et al. 2008 Pardue and DeBaryshe 2011) ( fig. 3). It is noteworthy that deletion of the RT coding region of the telomeric elements has occurred recurrently during Drosophila evolution, and multiple nonautonomous elements appear at the telomeres of the Drosophila species examined. As an example, up to four nonautonomous elements along with their corresponding autonomous elements have been found in D. mojavensis telomeres ( Villasante et al. 2007). Interestingly, similar situations occur with group II introns where their RTs also act in trans to mobilize multiple deleted introns ( Mohr et al. 2010).

Protože Drosophila telomeres consist of retrotransposon arrays in constant flux, there is not a specific terminal sequence and their telomere-capping proteins (the “terminin” complex) have evolved to bind chromosome ends independently of the primary DNA sequence ( Raffa et al. 2009, 2010). The “terminin” complex is functionally analogous to the “shelterin” complex (human telomere-capping proteins), but their components are not evolutionarily conserved ( Palm and de Lange 2008 Raffa et al. 2009, 2010). Tím pádem, Drosophila telomeres are made of rapidly evolving telomeric retrotransposons ( Villasante et al. 2007) and telomere-capping proteins ( Gao et al. 2010 Raffa et al. 2010). Moreover, as Verrochio is a telomere-capping protein with one OB-fold domain and all telomeric proteins containing OB folds are 3′-overhang binding proteins, Drosophila telomeres also seem to have single-strand overhangs ( Raffa et al. 2010).

It is noteworthy that, despite the complexity of telomeric sequences in the genus Drosophila a Chironomus, Drosophila telomeric retrotransposon arrays and the Chironomus telomeric complex repeats also have the telomeric G/C strand bias ( Nielsen and Edstrom 1993 Danilevskaya et al. 1998). The conservation of this G/C strand bias may indicate that telomere capping depends on the formation of noncanonical structures based on guanine–guanine interactions. In agreement with this idea, it has been shown that the 3′-untranslated region of the abundant D. melanogaster telomeric element HeT-A contains sequences with propensity to form G-quadruplexes ( Abad and Villasante 1999).

The structural and phylogenetic analyses of all Drosophila telomeric-specific retrotransposons show that they had a common ancestor and indicate that non-LTR retrotransposons have been recruited to perform the cellular function of telomere maintenance. Therefore, we propose that the recruitment of Drosophila telomeric elements may resemble the ancestral mechanism that led to the maintenance of the “proto-telomeres” of the first eukaryotic chromosomes.

On the other hand, it has been found that yeast cells lacking telomerase can survive telomere sequence loss through the formation of terminal blocks of heterochromatin. This happens by amplifying and rearranging either subtelomeric sequences in S. cerevisiae a S. pombe or rDNA sequences in S. pombe ( Lundblad and Blackburn 1993 Jain et al. 2010). Significantly, the S. cerevisiae subtelomeric Y’ repeats also have purine/pyrimidine strand bias ( Nickles and McEachern 2004), and the S. pombe end-protection protein POT1 (protection of telomeres 1) binds, in a nonsequence-specific manner, to the 3′-overhangs of G-rich rDNA ( Jain et al. 2010). Interestingly, adaptive recombination-based mechanisms of telomere maintenance (called ALT for alternative lengthening of telomeres) also occur in tumor cells that lack telomerase ( Bryan et al. 1995 Cesare and Reddel 2010).

To summarize, in species that have lost telomerase either during evolution (order Diptera) or through experimental manipulation, the data available suggest a role of structural DNA features in telomere maintenance, reveal the importance of telomeric heterochromatin (regardless of the underlying primary sequence) in the recruitment of end-binding proteins, and show how easily backup mechanisms may have been used to maintain telomeres during evolution.


Difference Between VNTR and STR

Definice

VNTR: VNTR is a type of tandem repeat in which a short sequence of nucleotides (10-60 base pairs) are repeated a variable number of times in a particular locus.

STR: STR is a type of tandem repeat in which a short sequence of nucleotides (2-6 base pairs) are repeated a variable number of times in a particular locus.

Number of Repeating Nucleotides

VNTR: VNTR consists of 10-60 base pairs.

STR: STR consists of 2-6 base pairs.

Type of Repetitive DNA

VNTR: VNTR is a type of minisatellite DNA.

STR: STR is a type of microsatellite DNA.

Number of Repeats

VNTR: VNTR consists of 10-1,500 repeats in the array.

STR: STR consists of 5-200 repeats in the array.

Size of the Array

VNTR: VNTR forms an array of 0.5-15 kb.

STR: STR forms an array of 10-1000 bp.

Complexity of the Array

VNTR: VNTR produces heterogeneous arrays.

STR: STR produces homogenous arrays.

Závěr

VNTR and STR are two types of tandem repeats that form arrays of adjacent repetitive units in the eukaryotic genome. VNTR consists of comparatively a long repeating units of nucleotides (10-60 base pairs). STR consists of short repeating units of nucleotides (2-6 bp). The main difference between VNTR and STR is the length of the repeating units of each type of tandem repeats.

Odkaz:

1. “Variable number tandem repeat.” ScienceDirect Topics, Available here.
2. “The Science of Forensic Genetics.” CRG – Council for Responsible Genetics, Available here.

Obrázek s laskavým svolením:

1. “D1S80Demo” By PaleWhaleGail at English Wikipedia (CC BY-SA 3.0 ) via Commons Wikimedia
2. “Stages of Gene Fingerprinting” By Sneptunebear16 – Own work (CC BY-SA 4.0) via Commons Wikimedia

O autorovi: Lakna

Lakna, absolventka molekulární biologie a amp biochemie, je molekulární biologka a má široký a živý zájem o objevování věcí souvisejících s přírodou


Binding and interaction of α-synucleinwith lipid membranes

Under normal conditions, α-synucleinexists as a randomly structured and natively unfolded protein and remains as a monomer within the cytoplasm. Under pathological conditions, however, α-synucleinundergoes structural/conformational changes causing the monomers to aggregate with each other and become insoluble. Much evidence suggests that changes to the α-synucleinstructure and properties are initiated when the protein binds and interacts with lipid surfaces, such as lipid droplets, phospholipid bilayers or lipid membranes. When α-synucleinmonomers, isolated from human neurons, were exposed to synthetic lipid membranes, they readily bound to the membrane surface and formed dimers and oligomers [56],[57]. Such an interaction is thought to induce a dramatic change in α-synucleinstructure from its unfolded form to a folded α-helical secondary structure [57]. The imperfect repeats of 11 amino acids present in α-synuclein, similar to the amphipathic α-helical motif common to apolipoproteins and other lipid-binding proteins, appear to play an important role in the lipid membrane binding process [58]. What is significant about such a change is that the α-helical form of α-synucleinis prone to forming different types of oligomers, the species that are thought to be toxic to cells. The lipid composition of membranes has been shown to affect the binding/interaction of α-synucleinto the membrane and subsequent oligomerization [56],[59]. α-synucleinis thought to preferentially bind to regions of membranes that are enriched in lipids [60]. These regions are called lipid rafts and are characterized by high concentrations of cholesterol and sphingolipids and altered surface charge that may favor α-synucleinbinding. The lipid rafts appear to serve as a platform that promotes α-synucleinbinding and oligomerization.

Contrary to overwhelming evidence that α-synuclein exists as an unfolded monomer in the cytosol, Bartels and colleagues reported that endogenous α-synuclein exists predominantly as a folded tetramer (

58 kDa) [61]. The explanation provided by the authors for this apparent difference is that most studies claiming the unfolded monomer hypothesis commonly use sample heating and denaturing gels to analyze α-synuclein, whereas the authors used nondenaturing conditions. They have also provided evidence by other means - that is, scanning transmission electron microscopy and cell cross-linking - to confirm the prevalence of α-synuclein tetramer in neurons and human brain tissues [61]. Bartels and colleagues proposed that since α-synuclein tetramers are less likely to form aggregates, the tetramers first undergo destabilization prior to forming aggregates. The authors suggested that stabilizing the physiological tetramers could reduce Contrary to overwhelming evidence that-synuclein pathogenicity in PD and other α-synucleinopathies.


Secondary Structure: α-Helices

An &alpha-helix is a right-handed coil of amino-acid residues on a polypeptide chain, typically ranging between 4 and 40 residues. This coil is held together by hydrogen bonds between the oxygen of C=O on top coil and the hydrogen of N-H on the bottom coil. Such a hydrogen bond is formed exactly every 4 amino acid residues, and every complete turn of the helix is only 3.6 amino acid residues. This regular pattern gives the &alpha-helix very definite features with regards to the thickness of the coil and the length of each complete turn along the helix axis.

The structural integrity of an &alpha-helix is in part dependent on correct steric configuration. Amino acids whose R-groups are too large (tryptophan, tyrosine) or too small (glycine) destabilize &alpha-helices. Proline also destabilizes &alpha-helices because of its irregular geometry its R-group bonds back to the nitrogen of the amide group, which causes steric hindrance. In addition, the lack of a hydrogen on Proline's nitrogen prevents it from participating in hydrogen bonding.

Another factor affecting &alpha-helix stability is the total dipole moment of the entire helix due to individual dipoles of the C=O groups involved in hydrogen bonding. Stable &alpha-helices typically end with a charged amino acid to neutralize the dipole moment.


Závěry

In this study, we applied an integrated omics approach to understand dinoflagellate secondary metabolite biosynthesis. To this end, we sequenced the genome of A. gibbosum and identified key features that regulate secondary metabolite levels and structural diversity. We hypothesize that miRNA-mediated, post-transcriptional regulation in A. gibbosum, which targets primary pyruvate metabolism, subsequently affects secondary metabolism. This study represents a first step to illuminate key molecular events involved in dinoflagellate secondary metabolism, and it should facilitate studies of HAB formation and associated toxin production. Ongoing high-throughput sequencing of dinoflagellate genomes promises to be informative, not only for understanding toxin secondary metabolism genes, but also for better insights into their genome organization. The availability of this first basal dinoflagellate genome provides important clues about dinoflagellate evolution and extends the genome size limit that has been a challenge for several years.


Primer Based Approach for PCR Amplification of High GC Content Gene: Mycobacterium Gene as a Model

The genome of Mycobacterium is rich in GC content and poses problem in amplification of some genes, especially those rich in the GC content in terminal regions, by standard/routine PCR procedures. Attempts have been made to amplify three GC rich genes of Mycobacterium sp. (Rv0519c a Rv0774c z M. tuberculosis a ML0314c z M. leprae). Out of these three genes, Rv0774c gene was amplified with normal primers under standard PCR conditions, while no amplification was observed in case of Rv0519c a ML0314c geny. In the present investigation a modified primer based approach was successfully used for amplification of GC rich sequence of Rv0519c through codon optimization without changing the native amino acid sequence. The strategy was successfully confirmed by redesigning the standard primers with similar modifications followed by amplification of ML0314c gen.

1. Úvod

Polymerase chain reaction (PCR) based cloning of gene of interest with high GC content is a long recognized problem. PCR is a most sensitive tool and various factors have to be optimized for amplification of gene of interest. Primer is one of the precise control elements in this process. Designing of primers directly influences the result of standardized cloning procedures. High GC content of the gene generates complication during primer designing like mismatch and high annealing temperature, self-dimer formation, and secondary structure. Sometimes, amplification of gene is not routinely achieved by normal PCR techniques. The most prominent problem associated is hairpin loop, which directly interferes during annealing of primers on difficult DNA template that leads to no amplification. Different strategies have been proposed to sort out this problem. Use of DMSO and glycerol was reported to reduce the annealing temperature and denaturation temperature, increase the chances of breakage of secondary structure, and increase the efficiency of amplification [1–5]. The whole genome sequence of Mycobacterium tuberculosis was deciphered by Cole et al. [6]. The genes of M. tuberculosis are being cloned and expressed in E-coli cells in order to identify their possible role in Mycobacterium život. The Mycobacterium genome has very high GC content (66%) which raised the possibility of hairpin structure in the genomic structure. From genome sequence analysis it was observed that PPE, PE, and PGRS multigene family code for proteins of approximately 110–80 amino acids rich in proline and glutamic acid at N-terminal position. Proline and glutamic acid residues are mainly coded by triplet of GC bases in Mycobacterium genom. Most of the genes for membrane proteins of M. tuberculosis were rich in GC content at terminal regions. Presence of high GC content increased the annealing temperature beyond the extension temperature (72°C) and also repeated stretches generate the hairpin structure. In such cases, effectiveness and reproducibility of PCR amplification depend on detailed analysis of the possible secondary structures of the oligonucleotide primers as well as formation of self-dimers and cross-dimers with other interrelating oligonucleotides [7]. Though these problems have been considered by several investigators, no systematic details are available to approach this problem.

In an attempt to clone GC rich genes (Rv0519c a Rv0774c z M. tuberculosis a ML0314c z M. leprae) from Mycobacterium sp., we designed primers by using standard method for gene amplification. Rv0774c a Rv0519c genes demonstrated 100% nucleotide identity in M. tuberculosis H37Rv and M. tuberculosis H37Ra. Proto, M. tuberculosis H37Ra chromosomal DNA was used as template for amplification of these two genes. We could amplify Rv0774c gene, but Rv0519c a ML0314c genes having high GC content at terminal region were not amplified by standard PCR procedures. Therefore, an attempt has been made in the present investigation to standardize the conditions and ingredients that favor the amplification of GC rich sequences.

2. Materiály a metody

2.1. Materiály

E-coli DH5α cells and pET-28a were procured from Invitrogen. Taq polymerase and dNTPs were purchased from Fermentas, USA. Restriction enzymes were purchased from New England Biolabs. Kanamycin, Middlebrook media, OADC, and tween 80 were purchased from Hi-Media, India. The strain Mycobacterium tuberculosis H37Ra was a kind gift from Director of National Institute of Leprosy and Other Mycobacterial Diseases, Agra, India. Genomic DNA for Mycobacterium leprosy was a kind gift from Dr. Mallika Lavania of Stanley Browne Laboratory, the Leprosy Mission, Nandnagri, Shahdara, New Delhi.

2.2. Mycobacterium Genomic DNA Isolation

M. tuberculosis H37Ra strains were routinely cultured for one week on middlebrook, 0.05% Tween 80, enriched with OADC. One week grown M. tuberculosis H37Ra cells (1.5 mL) were harvested by centrifugation at 5000 ×g for 20 min. Harvested pellet was resuspended in 400 μL Tris-EDTA buffer (100 mM Tris/10 mM EDTA, pH 8). The cells were lysed by putting the sample in boiling water bath for 5 min followed by cooling on ice for 5 min. Forty microliters of 20 mg/mL lysozyme and 5 μL of proteinase K were added. After 1 h of incubation at 37°C, solution A (56 μL of 10% SDS, 64 μL of CTAB-NaCl) was added to the reaction mixture. After 2 h of incubation at 65°C, proteins were removed by 2-3 times of washing with phenol : chloroform : isoamyl alcohol (25 : 24 : 1). The genomic DNA was precipitated with 0.6 volume of isopropanol at room temperature for 1 h. The precipitated DNA was dried and dissolved in sterile water and stored at −20°C.

2.3. Modification of Primers by Codon Optimization

Degeneracy of codon is normally used to overcome the existing problem including change of base at wobble position specific for coding sequence of Mycobacterium genom. Designed forward primer of Rv0519c contributes about 64% GC content and stretches of GC led to generation of complicated hairpin structure with high value of free energy change

G. By carefully examining the hairpin structure, introduction of the small base/pair distorted the whole secondary structure. The incorporation we opted in the primer sequence was as follows: guanine (G) base turned into adenosine (A) at wobble position of third codon CGG and thymine (T) to adenine (A) in codon CGT (Table 1). Similarly in reverse primer of Rv0519c primer sequence, the adenosine (A) base was turned into thymine (T) at wobble position of last sixth codon CGA. Mycobacterium leprae genome sequence also has high guanine and cytosine stretches. Reverse primer sequence of ML0314c z leprae gene was also modified. Guanine was turned into cytosine at wobble position of TCG codon. The effect of modification was analysed by IDT oligoanalyzer tools.


Podívejte se na video: GENETICS 3: CHROMOSOMES: ALU SEQUENCES (Listopad 2021).